Microbiology: An Introduction
11th Edition
ISBN: 9780321733603
Author: Gerard J. Tortora, Berdell R. Funke, Christine L. Case
Publisher: Benjamin Cummings
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 3R
Match the following examples of mutagens.
Column A | Column B |
___a. A mutagen that is incorporated into DNA in place of a normal base | 1. Frameshift mutagen |
___b. A mutagen that causes the formation of highly reactive ions | 2. Nucleoside analog |
___c. A mutagen that alters adenine so that it base-pairs with cytosine | 3. Base-pair mutagen |
___d. A mutagen that causes insertions | 4. Ionizing radiation |
___e. A mutagen that causes the formation of pyrimidine dimers | 5. Nonionizing radiation |
Expert Solution & Answer
Learn your wayIncludes step-by-step video
schedule05:07
Students have asked these similar questions
Explain with help of diagrams the mutagenic effects on DNA of following mutagens?
Below is an example
i. Ultraviolet light
ii. X- raysiii. Base analogsiv. Hydroxylaminev. nitrous acidvi. ethylmethane sulfonate
During an Ames test, bacteria were exposed to a potential mutagen.Also, as a control, another sample of bacteria was not exposedto the mutagen. In both cases, 10 million bacteria were plated andthe following results were obtained:No mutagen: 17 coloniesWith mutagen: 2017 coloniesCalculate the mutation rate in the presence and absence of the mutagen.How much does the mutagen increase the rate of mutation?
Mutations can arise in the absence of a mutagen.
please explain your answer
true
false
Chapter 8 Solutions
Microbiology: An Introduction
Ch. 8 - Briefly describe the components of DNA, and...Ch. 8 - DRAW IT Identify and mark each of the following on...Ch. 8 - Match the following examples of mutagens. Column A...Ch. 8 - The following is a code for a strand of DNA. a....Ch. 8 - Prob. 5RCh. 8 - Identify when (before transcription, after...Ch. 8 - Which sequence is the best target for damage by UV...Ch. 8 - You are provided with cultures with the following...Ch. 8 - Why are mutation and recombination important in...Ch. 8 - NAME IT Normally a commensal in the human...
Ch. 8 - Nucleoside analogs and ionizing radiation are used...Ch. 8 - Replication of the E. coli chromosome takes 40 to...Ch. 8 - Pseudomonas has a plasmid containing the mer...Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Feedback inhibition differs from repression...Ch. 8 - Bacteria can acquire antibiotic resistance by all...Ch. 8 - Suppose you inoculate three flasks of minimal...Ch. 8 - Plasmids differ from transposons in that plasmids...Ch. 8 - Mechanism by which the presence of glucose...Ch. 8 - The mechanism by which lactose controls the lac...Ch. 8 - Two offspring cells are most likely to inherit...Ch. 8 - Which of the following is not a method of...Ch. 8 - Ciprofloxacin, erythromycin, and acyclovir are...Ch. 8 - HIV, the virus that causes AIDS, was isolated from...Ch. 8 - Human herpesvirus-8 (HHV-8) is common in parts of...
Additional Science Textbook Solutions
Find more solutions based on key concepts
The light reactions of photosynthesis supply the Calvin cycle with A. light energy. B. CO2 and ATP. C. O2 and N...
Campbell Biology in Focus (2nd Edition)
What is the difference between cellular respiration and external respiration?
Human Physiology: An Integrated Approach (8th Edition)
QIdentify (stepwise) the process of purifying drinking water. What important contaminants are targeted by each ...
Brock Biology of Microorganisms (15th Edition)
Distinguish between microevolution, speciation, and macroevolution.
Campbell Essential Biology (6th Edition) - standalone book
All of the following processes are involved in the carbon cycle except: a. photosynthesis b. cell respiration c...
Human Biology: Concepts and Current Issues
Distinguish between the concepts of sexual differentiation and sex determination.
Concepts of Genetics (12th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Your company has decided to develop a PCR test that will be used to determine Huntington's disease. This genetic test will consist of a single PCR-amplification reaction of genomic DNA that will attach to the disease's gene either side of the repeated region to ensure amplification. Which of the following properties do you need consider when designing the orientation of the two primers relative to the template DNA? a) The primers’ 5′ → 3′ orientations must point toward each other when bound to the template. b) The primers’ 5′ → 3′ orientations must point away from each other when bound to the template. c) The primers’ 5′ → 3′ orientations must go in the same direction when bound to the template. d) The primers must be complementary to each other and to the template.arrow_forwardSome mutations affect changes in protein structure and function that can result in disease whereas other mutations have no significant effects on protein structure and function. Please explain reasons for the above mentioned statement. Human civilization has resulted in a large number of potentially mutagenic chemicals (e.g. pesticides) and has changed the environment to increase the likelihood of encountering other mutagens, especially UV radiation. What roles should the authorities play in identifying mutagens and regulating their release into the environment?arrow_forwardFill the Table with mutagenic agents and provide their type (physical, chemical, biological) and their classification based on their effect (teratogenic, carcinogenic, clastogenic, or non-specific), together with their modes of action. Mutagen Type of Mutagen Classification based on effect Action Cobalt Nickel Methylhydrazine Temozolomide Ethyl ethane sulfatearrow_forward
- a. Why is it impossible to induce nonsense mutations(represented at the mRNA level by the triplets UAG,UAA, and UGA) by treating wild-type strains with mutagens that cause only A• G → T• C transitions in DNA?b. Hydroxylamine (HA) causes only G• C → A• T transitions in DNA. Will HA produce nonsense mutations inwild-type strains?c. Will HA treatment revert nonsense mutations?arrow_forwardBelow is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…arrow_forwardIs each of the following mutations a silent, missense, nonsense, orframeshift mutation? The original DNA strand is 5′–ATGGGACTAGATACC–3′. (Note: Only the coding strand is shown; the firstcodon is methionine.)A. 5′–ATGGGTCTAGATACC–3′B. 5′–ATGCGACTAGATACC–3′C. 5′–ATGGGACTAGTTACC–3′D. 5′–ATGGGACTAAGATACC–3′arrow_forward
- What kind of mutation normally has no consequence? please explain the answer a.transversions b.insertion c.silent d.nonsensearrow_forwardA mutagen changes a C-G basepair in the genome to an A-T basepair. This is an example of... A different mutagen changes a C-G basepair in the genome to a T-A basepair. This is an example of... a. transition b. inversion c. transversion d. epigeneticarrow_forwardFill the Table with mutagenic agents and provide their type (physical, chemical, biological) and their classification based on their effect (teratogenic, carcinogenic, clastogenic, or non-specific), together with their modes of action. Mutagen Type of Mutagen Classification based on effect Action Heat 5-bromouracil Ethidium bromidearrow_forward
- Why are X rays more potent mutagens than UV radiation?arrow_forwardFill the Table with mutagenic agents and provide their type (physical, chemical, biological) and their classification based on their effect (teratogenic, carcinogenic, clastogenic, or non-specific), together with their modes of action. Mutagen Type of Mutagen Classification based on effect Action 2-aminopurine Acridine orange Proflavinearrow_forwardYou are working with a newly discovered mutagen, and you wish to determine the base change that it introduces into DNA. Thus far, you have determined that the mutagen chemically alters a single base in such a way that its base-pairing properties are altered permanently. To determine the specificity of the alteration, you examine the amino acid changes that take place after mutagenesis. A sample of what you find is shown here:Original: Gln–His–Ile–Glu–LysMutant: Gln–His–Met–Glu–LysOriginal: Ala–Val–Asn–ArgMutant: Ala–Val–Ser–ArgOriginal: Arg–Ser–LeuMutant: Arg–Ser–Leu–Trp–Lys–Thr–Phearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
What is cancer? What causes cancer and how is it treated? *UPDATE*; Author: Cancer Treatment Centers of America - CTCA;https://www.youtube.com/watch?v=_N1Sk3aiSCE;License: Standard Youtube License