Biology: The Unity and Diversity of Life (MindTap Course List)
15th Edition
ISBN: 9781337408332
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 9, Problem 12SQ
Summary Introduction
Introduction: Transcription is a process in which the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
_______is/are removed from a new mRNA. a. Introns c. A poly-A tail b. Exons d. Amino acids
In a polyribosome, the polypeptides associated with which ribosomes will be the longest?
a. Those at the 5′ end of mRNA
b. Those at the 3′ end of mRNA
c. Those in the middle of mRNA
d. All polypeptides will be the same length.
A nonsense mutation in a gene:
A.
introduces a premature stop codon into the mRNA
B.
changes an amino acid in the encoded sequence
C.
has no effect on the amino acid sequence of the encoded protein
D.
alters the reading frame of the mRNA
Chapter 9 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - RIPs as Cancer Drugs Researchers are taking a page...Ch. 9 - A chromosome contains many different genes that...Ch. 9 - A binding .site for RNA polymerase is called a ___...Ch. 9 - In cells, most RNA molecules are ___ ; most DNA...Ch. 9 - Prob. 4SQCh. 9 - The main function of a DNA molecule is to ________...Ch. 9 - The main function of an mRNA molecule is to ___ ....
Ch. 9 - Prob. 7SQCh. 9 - Prob. 8SQCh. 9 - Prob. 9SQCh. 9 - Anticodons pair with ___ . a. mRNA codons b. DNA...Ch. 9 - Prob. 11SQCh. 9 - Prob. 12SQCh. 9 - Prob. 13SQCh. 9 - Energy that drives translation is provided mainly...Ch. 9 - Match the terms with the best description. ______...Ch. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the .sequence of bases in the previous...Ch. 9 - Can you .spell your name (or someone else's) using...Ch. 9 - Bacteria use the.same stop codons as eukaryotes....
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The anticodon … A. is complementary to the mRNA B. is found on the ribosome C. is found on the tRNA D. A and Carrow_forward_______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acidsarrow_forwardPortions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps c. poly-A tails d. intronsarrow_forward
- Imagine that a mutation in a DNA molecule results in the codon CCU being changed to CCC. Both of these codons code for proline. The fact that more than one codon can code for the same amino acid is referred to as ___ a. the ambiguity of the genetic code b. the redundancy of the genetic code c. the randomness of the genetic code d. mutations in the genetic codearrow_forwardIf a eukaryotic mRNA has failed to have a cap attached to its 5' end, what would the negative consequence(s) be? I chose b and got this questions wrong, why is this wrong? a. The mRNA would not properly exit the nucleus. b. The mRNA would not properly bind to a ribosome. c. The mRNA would not receive a poly A tail. d. The mRNA would not use the correct start codon. e. Both a and b are correct.arrow_forwardIf a mutation deletes the start codon in a eukrayotic gene, which of the following most accurately describes its consequence? A. There will be no mRNA or polypeptide made. B. The mRNA will be made but no polypeptide is made. C. The mRNA will not be processed properly. D. Nothing will happen. It is a silent mutation.arrow_forward
- Which of the following best describes mRNA?Group of answer choices a) Complexes with ribosomal proteins to form ribosomes b) Transports amino acids to ribosomes during translation c) Provides the instructions for the amino acid sequence of a polypeptide d) Used for eukaryotic RNA processingarrow_forwardUse your genetic code (codon) table to answer the next two questions: What type of mutation would result if the sequence of a gene were altered so that the sequence of the mRNA was changed from: AUGCCGUGCAGUAAC to AUGCCAUGCAGUAAC A) a silent mutation B) a nonsense mutation C) a frame-shift mutation D) a missense mutation E) a base insertion mutationarrow_forwardThe Kozak rules determine a. the choice of the start codon in complex eukaryotes. b. the choice of the start codon in bacteria. c. the site in the mRNA where translation ends. d. how fast the mRNA is translated.arrow_forward
- A mutation occurs that alters the third base in an mRNA codon from a C to a G. This mutation is most likely a A. frameshift mutation B. missense mutation C. nonsense mutation D. silent mutationarrow_forwardA single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.arrow_forwardA portion of an mRNA molecule that determines one amino acid in apolypeptide chain is called a(n)a. nucleotide. b. gene. c. codon. d. exon. e. intronarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license