MindTap Biology, 1 term (6 months) Printed Access Card for Starr/Taggart/Evers/Starr's Biology: The Unity and Diversity of Life (MindTap Course List)
14th Edition
ISBN: 9781305269842
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 14SQ
Energy that drives translation is provided mainly by_________.
- a. ATP
- b. amino adds
- c. GTP
- d. all are correct
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
A single template strand of a DNA molecule is represented by
3’atgtaccatgcgcaaatttaaaggccc5’.
a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications?
b) Write the amino acid sequence of your mature mRNA.
c) List the molecules involved in translation and briefly describe their function.
Once translated into proteins:
(a) How many nucleotides are there?
(b) How many codons are there?
(c) How many amino acids?
1. Translation
a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.
Chapter 9 Solutions
MindTap Biology, 1 term (6 months) Printed Access Card for Starr/Taggart/Evers/Starr's Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 9 - A chromosome contains many different genes that...Ch. 9 - A binding .site for RNA polymerase is called a ___...Ch. 9 - An RNA molecule is typically ______; a DNA...Ch. 9 - RNAs form by_____; proteins form by ________. a....Ch. 9 - The main function of a DNA molecule is to ________...Ch. 9 - The main function of an mRNA molecule is to ___ ....Ch. 9 - Prob. 7SQCh. 9 - Prob. 1DAACh. 9 - Prob. 2DAACh. 9 - Prob. 3DAA
Ch. 9 - Prob. 4DAACh. 9 - Prob. 8SQCh. 9 - Anticodons pair with ___ . a. mRNA codons b. DNA...Ch. 9 - Up to ______ amino adds can be encoded by an mRNA...Ch. 9 - Prob. 11SQCh. 9 - Prob. 12SQCh. 9 - Prob. 13SQCh. 9 - Energy that drives translation is provided mainly...Ch. 9 - Match the terms with the best description. __...Ch. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the .sequence of bases in the previous...Ch. 9 - Bacteria use the.same stop codons as eukaryotes....
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The wobble position of codons occurs A. before the 2nd base B. after the ribosome initiates a stop codon C. at the 3rd base D. when the ribosome falls apartarrow_forward_______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acidsarrow_forwardTranslation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCUarrow_forward
- A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an mRNA transcript contains the codon for this tRNA? A. The tRNA will not bind to this codon. B. Translation stops and the protein is released. C The wrong tRNA is added to the protein chain. D. Translation stops and the protein remains bound to the ribosome.arrow_forwardUse your genetic code (codon) table to answer the next two questions: What type of mutation would result if the sequence of a gene were altered so that the sequence of the mRNA was changed from: AUGCCGUGCAGUAAC to AUGCCAUGCAGUAAC A) a silent mutation B) a nonsense mutation C) a frame-shift mutation D) a missense mutation E) a base insertion mutationarrow_forwardImagine that a mutation in a DNA molecule results in the codon CCU being changed to CCC. Both of these codons code for proline. The fact that more than one codon can code for the same amino acid is referred to as ___ a. the ambiguity of the genetic code b. the redundancy of the genetic code c. the randomness of the genetic code d. mutations in the genetic codearrow_forward
- A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)arrow_forwardConsidering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'arrow_forwardWhat site on the ribosome is the place where a tRNA molecule leaves the ribosome after attaching its amino acid to the growing chain of amino acids? a. E site b. P site c. A site d. the small ribosomal subunit Please respond as soon as possiblearrow_forward
- The Kozak rules determine a. the choice of the start codon in complex eukaryotes. b. the choice of the start codon in bacteria. c. the site in the mRNA where translation ends. d. how fast the mRNA is translated.arrow_forwardThe function of the genetic code is toa. promote transcription.b. specify the amino acids within a polypeptide.c. alter the sequence of DNA.d. do none of the above.arrow_forwardThe release factors RF1 and RF2 are required for a. translation termination b. the realease of the aminoacid from the tRNA c. translation elongation d. translation initiationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license