menu
bartleby
search
close search
Hit Return to see all results
close solutoin list

The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-

BuyFindarrow_forward

Human Heredity: Principles and Iss...

11th Edition
Michael Cummings
Publisher: Cengage Learning
ISBN: 9781305251052

Solutions

Chapter
Section
BuyFindarrow_forward

Human Heredity: Principles and Iss...

11th Edition
Michael Cummings
Publisher: Cengage Learning
ISBN: 9781305251052
Chapter 9, Problem 18QP
Textbook Problem
105 views

The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations.

  1. a. met-trp-
  2. b. met-cys-ile-val-val-leu-gln-
  3. c. met-trp-tyr-arg-ser-pro-thr-
  4. d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-

a.

Summary Introduction

To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-trp”.

Introduction: The proteins are coded from triplet codons. There are 64 triplet codons, which code for 20 amino acids in which initiation and stop codons are also included. The initiation codons allow the mRNA to transcribe the DNA template while stop codons restrict the translation.

Explanation of Solution

The possible triplet codons for the normal protein “met-trp-tyr-arg-gly-pro-thr” are as follows:

MetTrpTyrArgGlyProThr
AUGUGGUAUAGAGGUCCUACU
  UACAGGGGCCCCACC
    GGACCAACA
    GGGCCGACG

These are the possible triplet codons for “met-trp-tyr-arg-gly-pro-thr” protein...

b.

Summary Introduction

To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-cys-ile-val-val-leu-gln”.

Introduction: The proteins are coded from triplet codons. There are 64 triplet codons which code for 20 amino acids in which initiation and stop codons are also included. The initiation codon allows the mRNA to transcribe the DNA template; whereas, stop codons restrict the translation.

c.

Summary Introduction

To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-trp-tyr-arg-ser-pro-thr”.

Introduction: The proteins are coded from triplet codons. There are 64 triplet codons which code for 20 amino acids in which initiation and stop codons are also included. The initiation codon allows the mRNA to transcribe the DNA template; whereas, the stop codons restrict the translation.

d.

Summary Introduction

To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-”.

Introduction: The proteins are coded from triplet codons. There are 64 triplet codons, which code for 20 amino acids in which initiation and stop codons are also included. The initiation codon allows the mRNA to transcribe the DNA template; whereas, the stop codons restrict the translation.

Still sussing out bartleby?

Check out a sample textbook solution.

See a sample solution

The Solution to Your Study Problems

Bartleby provides explanations to thousands of textbook problems written by our experts, many with advanced degrees!

Get Started

Chapter 9 Solutions

Human Heredity: Principles and Issues (MindTap Course List)
Show all chapter solutions
add

Additional Science Textbook Solutions

Find more solutions based on key concepts
Show solutions add
The appetite-stimulating hormone ghrelin is made by the a. brain b. fat tissue c. pancreas d. stomach

Nutrition: Concepts and Controversies - Standalone book (MindTap Course List)

Can a metamorphic rock be metamorphosed?

Fundamentals of Physical Geography

The enzyme trypsin is sold as a dietary supplement. What happens to trypsin taken with food?

Biology: The Unity and Diversity of Life (MindTap Course List)

If you stretch a rubber hose and pluck it, you can observe a pulse traveling up and down the hose. (i) What hap...

Physics for Scientists and Engineers, Technology Update (No access codes included)

In what sense is a black hole actually black?

Foundations of Astronomy (MindTap Course List)

How is salinity determined?

Oceanography: An Invitation To Marine Science, Loose-leaf Versin