Researchers are designing and testing antisense drugs as therapies for a variety of diseases, including cancer, AIDS, diabetes, and muscular dystrophy.  The drugs are also being tested to fight infection by deadly viruses such as Ebola.  Antisense drugs consist of short RNA strands complementary in sequence to mRNAs that form during the progression of a disease.  How do you think these drugs work?

Q: What is the role of transcription in the determination of the amino acid sequence of a polypeptide…

A: Transcription is the initial stage in gene expression, when information from a gene is used to build…

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: If a mutation deletes the promoter in a eukrayotic gene, which of the following most accurately…

A: mRNA means messenger RNA. mRNA forms from the template DNA strand. The template DNA strand is used…

Q: Researchers are designing and testing antisense drugs as therapies for a variety of diseases,…

A: An antisense drug is a medication containing part of the non-coding strand of messenger RNA, a key…

Q: A scientist, Dr. Doom  would like to create a novel antibiotic by targeting translation in bacterial…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: Why will a mistake in the RNA code alone not become a mutation?

A: A change in the genetic code is called a mutation when it becomes a permanent part of the genome of…

Q: According to the adaptor hypothesis, is each the following statementstrue or false?A. The sequence…

A: Introduction: According to the adaptor hypothesis, the RNA molecules would be connectors that could…

Q: Which type of gene controls functions like an "on-off" switch for gene transcription? A. DNA…

A: Option D is the correct answer

Q: A genetic researcher notices that individuals with a particular genetic disease have a shortened…

A: Silent Mutation : As the name says silent mutation, these are the mutations in DNA which doesn't…

Q: Use your DNA strand to construct a part of a messenger RNA molecule.            DNA            A G T…

A: When DNA is converted into mRNA then this process is called transcription.Transcription occurs in…

Q: If a DNA sequence (exons and introns) and the regions upstream/downstream are normal -- but no mRNA…

A: During RNA splicing Introns are removed and Exons ligated together to give rise to a functional RNA…

Q: If the nonsense mutation is in the last exon of the mRNA, the result would be:

A: Exons are sections of an RNA transcript, that code for a protein. Exons are separated by non-coding…

Q: Give two DIFFERENT examples of how the following can occur: a. A point mutation in an exon that is…

A: Silent mutation - Silent mutations are mutations in DNA that do not have an observable effect on the…

Q: What is RNA editing, how can it increase the number of proteins that can be formed from a single…

A: RNA editing also participated in the variations of proteomics sequence. In many types of cancers…

Q: Which of the following is not a function of the 5’ cap and 3’ poly-A tail of a mature eukaryotic…

A: Introduction: RNA polymerase is an enzyme that copies DNA. The RNA polymerase binds to the promoter…

Q: You observe a piece of mRNA. A few minutes later you see this mRNA has now been converted into DNA.…

A: mRNA is the messenger ribonucleic acid that is produced by the process of transcription. The RNA…

Q: Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C.…

A: Hello, thank you for your question, since you have not mentioned the DNA orientation I am answering…

Q: ic code helps for protein synthesis.

A: Ribosomes are known as minute particles which consist of RNA and  the associated proteins that…

Q: Which would be more harmful to a cell, a mutation in DNA or a transcription mistake that leads to an…

A: Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) molecules are genetic materials, which are…

Q: How is translation different in prokaryotes and eukaryotes? a. In prokaryotes, because they do not…

A: Translation is a process which takes place after transcription, in which the genetic information…

Q: How many bases would a mRNA have? if it was coded for a protein of 250 amino acids long? explain…

A: The flow of genetic information in a biological system is explained by central dogma and it involves…

Q: How many mRNA nucleotides does it take to code for a polypeptide that is 30 amino acids long?…

A: on the mRNA, we have codons that code for very specific amino acids. we have 61 codons that code for…

Q: The diagram below shows a hybridization experiment between a eukaryotic MRNA and the template strand…

A: It was performed using both the cytoplasmic RNA (ribonucleic acid) and nuclear pre-mRNA (messenger…

Q: Suppose that a gene has a mutation that changes one nucleotide. Compared to the protein produced…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: Imagine that you and your colleagues are working in a lab to develop a protein synthesis system for…

A: The mRNA in prokaryotes is polycistronic, while the mRNA in eukaryotes is monocistronic.…

Q: Give two examples of places you could have mutations in the DNA sequence of a eukaryotic gene that…

A: The change in the heritable characteristics of the species across many generations is called…

Q: What happens during the TERMINATION step of transcription? A. base pairs are added to the mRNA…

A: Transcription is a process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: What is antisense RNA? How does it affect the translation of a complementary mRNA?

A: The DNA is replicated via a process called DNA replication. After this process, the DNA enters in…

Q: The transmission of information is from DNA to RNA to proteins. Would it not be more efficient for…

A: The central dogma states that the DNA can replicate to form another DNA i.e. from parent to daughter…

Q: A scientist studies the production of a key digestive enzyme in silk moths. The moths have one gene…

A:

Q: How would you make a copy of DNA from an mRNA transcript,what is this molecule called, and how would…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Which of the following is a true statement concerning RNA? Group of answer choices a. mRNA is single…

A: The RNA or ribonucleic acid is a nucleic acid polymer that it is produced from the DNA by the…

Q: What are the classes of mutations that can be made in the genetic code? In your own words describe…

A: Proteins are important for the normal functioning of the human body. Proteins are made of amino…

Q: In which of the following does nitrogenous base pairing (base complementarity via hydrogen bonds)…

A: Nitrogenous base pairing can include DNA-DNA, DNA-RNA, RNA-RNA pairing. Both DNA and RNA are made up…

Q: Why does the mRNA need to be protected from the enzymes in the cell?

A: mRNA need to be protected from the  enzyme  in the cell to inhibit from degradation.  If mRNA get…

Q: In RNA silencing, siRNAs and miRNAs usually bind to which part of the mRNA molecules that they…

A: Small interfering RNAs or siRNAs and micro RNAs or miRNAs are those RNA segments that don't code for…

Q: Suppose you are studying two different mutations in a gene that codes for a protein. In the first, a…

A: Proteins are made up of amino acids that joins together by peptide bonds. The synthesis of protein…

Q: Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: a mutation occurred in the g of the codon below and the G became a C   A  T  G Changes to A  T  C…

Q: Addition or deletion of bases causes which kind of mutation?

A: Mutation can results in the alteration of nucleotide sequence of DNA that leads to cause DNA damage.…

Q: Which is TRUE about alternative splicing?  Group of answer choices it allows for manufacture of…

A: Question - Which is TRUE about alternative splicing?  Group of answer choices it allows for…

Q: Now imagine that a mutation occurred in the second T of the codon below and the T became a G. How…

A: A mutation occurs when there is a change in the nucleic acid sequence. These mutations could be…

Q: Which two of the following statements about transcription are true A. Transcription makes an RNA…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: What is a promoter? Group of answer choices A region on mRNA that will indicate the ending point…

A: Promoter These are the DNA sequences which defines where the transcription of gene by RNA polymerase…

Q: Which of these is the function of a poly (A) signal sequence? A. It adds the poly (A) tail to the 3'…

A: In the yeast the poly (A) signal sequences are present which are short sequences and redundant in…

Q: You know how the body using mRNA to create protein. Describe to someone how the cell will be able to…

A: mRNA vaccines instruct our cells about how to produce a protein that triggers an immune response…

Q: The information in DNA is used by cells to produce proteins that perform various functions in cells.…

A: Transcription is the formation of a sequence of RNA using DNA as a template and DNA dependent RNA…

Q: This type of mutation, where one nucleotide was replaced for another, is called a point mutation.…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Such as in the case of sickle-cell disease, which of the following can occur from the mutation of…

A: Gene mutation is the change in expression of a gene which is caused by change in a single base pair…

Q: People who have muscular dystrophy have something called a “mutation.” How does that mutation arise?…

A: Muscular dystrophy is a group of inherited diseases that damage and weaken your muscles over time.…

Q: DNA methylation is a potential example of A. post-translational control B. translational control C.…

A: DNA methylation is a biological process by which methyl groups are added to the DNA molecule. In…

Cancer Therapy