Answered: The main function of an mRNA molecule…

Name: The main function of an mRNA molecule is to_______ . a. store heritabl
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The main function of an mRNA molecule is to_______ . a. store heritable information b. carry a translatable message c. form peptide bonds between amino acids

Science

Biology

The main function of an mRNA molecule is to_______ . a. store heritable information b. carry a translatable message c. form peptide bonds between amino acids

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 2SQ

See similar textbooks

Similar questions

_______is/are removed from a new mRNA. a. Introns c. A poly-A tail b. Exons d. Amino acids
A nonsense mutation in a gene: A. introduces a premature stop codon into the mRNA B. changes an amino acid in the encoded sequence C. has no effect on the amino acid sequence of the encoded protein D. alters the reading frame of the mRNA
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
If a eukaryotic mRNA has failed to have a cap attached to its 5' end, what would the negative consequence(s) be? I chose b and got this questions wrong, why is this wrong? a. The mRNA would not properly exit the nucleus. b. The mRNA would not properly bind to a ribosome. c. The mRNA would not receive a poly A tail. d. The mRNA would not use the correct start codon. e. Both a and b are correct.
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.
The set of mRNAs present within a cell changes over time.Explain.
Energy that drives translation is provided mainly by ______ . a. ATP c. GTP b. amino acids d. ribosomes
A mutation takes place that switches a codon from ACG to ACA. What type of mutation is this? A) nonconservative missense B) silent C)nonsense D) Conservative missense
The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome: Choose the sequence that would correspond to that mRNA. A: 3’ – TACGGAACG – 5’ B) 3’ – AUGCCUUGC – 5’ C) 5’ – AUGCCUUGC – 3’ D) 3’ – UACGGAACG – 5’ E) 5’ – UACGGAACG – 3’
Which statement regarding UTRs is TRUE? a) Transcription begins at the start of the 5' UTR b) Translation begins at the start of the 5' UTR c) The 5' and 3' UTRs are spliced from the mRNA transcript d) The translation stop codon is found downstream of the 3' UTR
Select the best answer or answers from the choices given: If DNA has a sequence of AAA, then a segment of mRNA synthesized on it will have a sequence of (a) TTT, (b) UUU, (c) GGG, (d) CCC.
After tmRNA releases an mRNA and aberrant polypeptide from a stuck ribosome, the resulting polypeptide will A) be translated B) be destroyed by a protease C) be inserted into the cell membrane D) be used to regulate gene expression