1.Knowing that the Control is 6.22 x 10- moles.channel-2sec-1 and the CFTR-CRISP is 3.84x 10-20 moles.channel-2.sec-1 Show me how they got their answer and explain how?
Q: plz state 2 importance of the following importance of, algal bloom: Phylum Chlorophyta, Phylum…
A: Algal blooms are rapid and excessive growths of algae in water bodies, which can lead to the…
Q: Explain briefly how proteins synthesized in the cytosol get into mitochondrial matrix.
A: Protein synthesis refers to the process by which cells generate new proteins, which are essential…
Q: A) What is resident flora? B) How might resident flora prevent infection AND cause infection?
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: Conclusion: Which regulatory mechanisms promote the increase of MLV during exercises
A: According to the given question ,the column to be filled following the graph algorithm provided is…
Q: Tapeworms are common parasites. Which of the following categories best describes a tapeworm? A.…
A: ANSWER) Tapeworms are the parasites which are capable of living in the human intestine and can cause…
Q: 1.What impact does lameness have on dairy cows in Puerto Rico?
A: lamenesses is A state of being unable to walk because of leg or foot pain is lameness. Old dog's…
Q: A bacterial organism is catalase positive and cytochrome oxidase positive. This could suggest that…
A: The oxidase test is a biochemical test that is used to determine the presence of an enzyme called…
Q: A discrete, identifiable physical feature or behaviour of an organism present in every individual of…
A:
Q: What is the correct Labelling? the above labelling is wrong.
A: The diagram depicts the C4 cycle also called Hatch and Slack pathway. This pathway efficiently fix…
Q: How have opiate analgesics been reformulated to reduce undesireable side effects?
A: Introduction Analgesics are a class of drugs that are used to relieve pain. They work by reducing…
Q: In their case-control study investigating the link between smoking and lung cancer, Doll and Hill…
A: Control selection is the process of selecting participants who do not have the outcome of interest…
Q: Which of the following drug classes is named according to its characteristic large chemical ring…
A: Macrolide antibiotics include drugs such as erythromycin, azithromycin, and clarithromycin, among…
Q: Select the statements that correctly describe hydroelectric power. Its plants have short lifespans…
A: Introduction: Environmental pollution refers to the presence or introduction into the environment of…
Q: application. NOTE: If none of the options are correct, you MUST select #4for 'none of the above',…
A: All these are plant hormones with different functions. These are produced in extremely low…
Q: Describe and explain sources of errors in this experiment. Provide practical suggestions for…
A: Protein solubility refers to the ability of a protein to dissolve in a solvent such as water, and is…
Q: b. Do the annual rings of the fish scale remind you of growth rings found in another, very different…
A: Growth rings are an intriguing characteristic of certain organisms that indicate their age and…
Q: 10.
A: Epigenetic regulation refers to the mechanisms that control gene expression without changing the…
Q: Give typing answer with explanation and conclusion How are these two processes (photosynthesis and…
A: Introduction :- Photosynthesis is the process by which plants, algae, and some bacteria convert…
Q: What mechanisms does the phagolysosome use to kill the thing that was brought into the cell?
A: Introduction The immune response is a complex biological process by which the body's immune system…
Q: Using the data available Using the data available on Moodle describe the phenotype that you observe…
A: RNA interference (RNAi) is a successful strategy for examining gene action and direction. Analysts…
Q: The ______ phase of HIV infection is asymptomatic. This is the phase in which HIV replication…
A: Introduction : AIDS, also known as acquired immunodeficiency syndrome, is a chronic, potentially…
Q: Journal research update related to OB Surgical published from 2021 to 2023. And attach a reaction…
A: Introduction OB surgical refers to surgical procedures that are performed during pregnancy,…
Q: phosphofructokinase is an allosteric enzyme that catalyzes the conversion of fructose 6-phosphate to…
A: In mammals, the allosteric regulation of phosphofructokinase is primarily achieved through the…
Q: Accessibility to playgrounds and/or parks could potentially help reduce childhood obesity. As an…
A: Study design refers to the specific plan or strategy that researchers use to conduct a study and…
Q: 2. Carefully analyze the following images. D A X ! E | B a. Describe each as _n= (1 or 2 "sets" of…
A: Cell division is a process in which parent cell splits and give rise to new cell . Number of new…
Q: Why is penicillin toxic to bacteria but not to higher organism? Explain briefly
A: Penicillin is an antibiotic drug that was discovered in 1928 by Alexander Fleming, a Scottish…
Q: Sucrose-6-P Glucose-6-P Cytoplasm Cell wall Cell membrane hasC Glucose-1-PUDP-Glucose hasB HA…
A: Operon is a group of genes that is present in the same region of the DNA. It consists of a…
Q: Your friend Chad is carrying some firewood in his outstretched arms. While his eyes are closed…
A: Introduction The Golgi tendon is a proprioceptive sensory receptor located in the tendons of…
Q: A patient visits an urgent care center with complaints of a stiff neck and headache. While…
A: Flow cytometry is a technology used to analyze individual cells or particles in a fluid suspension.…
Q: ab questions (due at the start of the You will examine four different phyla this week. Which of…
A: Acoelomates-An acoelomate is an animal that does not possess a body cavity or coelom.…
Q: make a mind map for N2 fixation. amino acid synthesis and amino acid degredation.
A: The mechanism of biologically fixation of nitroge is a process in which aerobic nitrogen is…
Q: Why is a positive and a negative control used in a Elisa experiment?
A: The enzyme-linked immunosorbent assay (ELISA) is a laboratory technique for detecting and…
Q: Would you donate a kidney to a friend of family member whose kidneys were failing? Would you…
A: Living kidney donation is one of the best options for the people needing new kidney. To donate to a…
Q: The drug tamoxifen has been used to treat some types of breast cancer. Suppose even among female…
A: Breast cancer is one of the most common cancers affecting women worldwide. Tamoxifen, a selective…
Q: How much dry matter (kg/DM per day) does a 500kg cow in early lactation producing 1.7kg milksolids…
A: To calculate the dry matter intake required for a 500kg cow in early lactation producing 1.7kg of…
Q: The resting membrane potential is established by? The Na+/K+-ATPase pumping Na+ into the cell and…
A: Introduction Resting membrane potential is the electrical charge difference that exists across the…
Q: Please put your answer in the word document link provided.…
A: Criminal Investigation: Criminal investigation is the process of gathering evidence and information…
Q: Consider a one-locus system of simple dominance where the presence of at least one G allele results…
A: A genotype is a scoring of the type of variant present at a given location (i.e., a locus) in the…
Q: Variation in Alleles Allele frequency - Allele frequency, or gene frequency, is the relative…
A: Introduction An allele is one of the possible forms of a gene that is found at a specific location,…
Q: Identify the solution or solutions with the highest concentration of water. Justify your answer.…
A: Osmolarity: Osmolarity is a measure of the concentration of a solution expressed as the number of…
Q: A single meal a day is enough to feed a cat. Is that premise a myth or a reality? explain
A: Cats' dietary demands and eating habits are affected by their evolutionary history as hunters.…
Q: 2. In some cats the gene for tail length shows incomplete dominance. Cats with long tails and those…
A: A heterozygous one that exhibits an intermediate phenotype between two homozygous phenotypes is…
Q: The effects of climate change on the sustainbility of the seafood industry now and in the future…
A: Sustainability is the ability to maintain a certain level of activity or a particular state or…
Q: The hormone oxytocin relaxes the muscles and ligaments in the pelvis and softens the cervix in…
A: In addition to being released during intercourse, following ovulation, labor, childbirth, and…
Q: Give typed full explanation A drug has been developed that blocks complex 1 of the mitochondria…
A: The electron transport chain is a series of membrane-associated protein complexes located in the…
Q: Benzodiazepines bind to & activate GABA receptors. This drug is: (SELECT 2) (a) Direct (b)…
A: Introduction: Benzodiazepines are a class of psychoactive drugs that are commonly used to treat…
Q: All of the following are epidemiological study designs are "observational" in nature, except a.…
A: The incidence and distribution of diseases and health-related events in populations are studied…
Q: 7. please answer this
A: Homozygous and heterozygous are terms used to describe the genetic makeup or genotype of an…
Q: Where and how photosynthesis occurs? What are its products?
A: introduction Green plants and some other animals transform solar light energy into chemical energy…
Q: Calculate the pasture mass (kgDM/ha) for cows, given a (RPM) plate meter start reading of 9566, a…
A: The RPM plate meter measures the compressed height of pasture in half-centimeter increments. The…
Step by step
Solved in 2 steps
- Search (Option + Q) rences Review View Help Editing v A^ Dv A A A Question 1 During nucleic acid hybridization, the probe is labelled for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 10 IV 12 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessiveDesign alibri Y Layout 12.5 O I Uabe X₂ X² A-ay-A Font mRNA: Unique Unigriffin DNA: traits: ▼ wwww DNA: to search mRNA: References 13 A A Aa-A5-5-5- mRNA: amino acids: traits: DNA: # > amino acids: traits: How DNA Determines Traits- Transcription and Translation Fill in easier type.pptx part 2 - Word Mailings Review View ACROBAT Tell me what you want to do... A¶ | CAG TCG TTT | ATG GGG CTT CTT TIT | GAG AAT TCA CGC | wwwww | CGA CAA CAC | GTA GTA | CAA AAA ATG | TTA TAG AAT GAC GGG TGG | wwww 14 | TTA TTG TTA CGG | AAA AGA CCT | GCA GCC TTG TGT | O $ Paragraph =-12-18 15 % AaBbCcDc AaBbCcl AaBbCcL AaBbCcDc AaBb CcDc ¶ Normal T Body Text 1 List Para... 1 No Spac... 1 Table Par... Styles 16 W 18 7 C fg OM f10 num lk (p)) 捆 AaBbCc[ Aa Bb 1 Heading 1 1 Head 10000 00000 J 0 36°FQuestion:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCG
- וןווד ← Q Lab Report 6 worksheets 314 F22 .DOCX File Edit View Insert Format Tools Help A 100% ¿ Summary Grades for Arysta Visser: 23 x M Uh-oh! There's a problem w X b The restriction EcoRI cleaves X + Untitled spreadsheet - Goog X https://docs.google.com/document/d/1mKY1HIgMPRh1kRDCmX7msBF2yf07-ogT/edit Outline Headings you add to the document will appear here. Normal text Times ... 12 + B I U 2 18. The restriction EcoRI cleaves double-stranded DNA at the sequence 5'-GAATTC-3', the restriction enzyme HindIII cleaves at the sequence 5'-AAGCTT-3', and the restriction enzyme BamHI cleaves at 5'GGATCC-3. An 805 bp circular plasmid is digested with each enzyme individually and then in combination, and the resulting fragment sizes are determined by means of electrophoresis. The results are as follows: 1 Restriction Enzyme(s) EcoRI BamHI HindIII EcoRI and BamHI EcoRI and HindIII BamHI and HindIII 3 Practice ====•=•€ EX Fragment lengths (base pairs) 430 bp, 375 bp 470 bp, 335 bp Lab Report 6…Section Name MAPPING PRACTICE #4 Plasmid pBR 607 is a 2.6 Kb plasmid containing Ampicillin and Tetracycline resistance markers, an origin of replication, and unique restriction sites for the restriction enzymes EcoRI, BamHI, and Pstl. Given the restriction map for pBR 607 for the enzymes EcoRI, BamHI, and Pstl, show on the gel diagram, where the approximate positions of the restriction fragments generated from the restriction digests would be located after carrying out electrophoresis. BamHI 0.2 Kb pBR 607 ECORI 1.94 Kb 0.46 Kb Pstl Size EcoRI EcoRI EcoRI + Standards BamHI + Pstl BamHI Pstl 4.0 Kb 2.2 Kb 2.0 Kb 0.5 Kbme Insert Design at Painter 278 words Calibri Layout 11.5A A Aa BIU-abe X₂ X² A--A- ype here to search Font W Unique Unigriffin DNA: mRNA: amino acids: traits: DNA: mRNA: amino acids: traits: DNA: mRNA: amino acids: traits: References # M 3 How DNA Determines Traits- Transcription and Translation Fill in easier type.pptx part 2 - Word Tell me what you want to do... Mailings Review View A-6-5- LLI Paragraph | CAG TCG TTT | ATG GGG CTT CTT TIT | GAG AAT TCA CGC I S4 | CGA CAA CAC | GTA GTA | CAA AAA ATG | TTA TAG AAT GAC GGG TGG | wwwwww O 2 A W R =-- | TTA TTG TTA CGG | AAA AGA CCT | GCA GCC TTG TGT | de in ACROBAT % 5 ¶ T 1 Normal AaBbCcDc AaBbCcl AaBbCcL AaBbCcDc AaBbCcDc AaBbCc[ AaBbCcD Aal 1 Body Text 1 List Para... 1 No Spac... 1 Table Par... Heading 1 1 Heading 2 Hea Styles Y 7 OM O 38°F JACQUI 10 L
- Search (Option + Q) Review View Help Editing v B IU ev Av A =<而< 面 三< A Question 16 The full set of different transcripts expressed by a cell is called Proteome Genome Transcriptome Glycome Question 17 One of the major drawback of using Microarray over RNA sequencing for high throughput sequence analysis is allows quantification of transcripts over five orders of magnitude usei to identify new transcripts and alternative isoforms RNA-Seq is sensitive and offers a way of profiling transcripts of single cells a significant amount of input RNA is required Question 18 Which of these statements are not true for the DNA libraries: Genomic DNA libraries are collection of cloned DNA fragments representing the genome from an organism. Genomic DNA is completely (fully) digested with restriction endonuclease. Complementary DNA (CDNA) libraries are derived from reverse transcribed RNA Genomic DNA is partially digested with restriction endonuclease.patibility Mode] UE Layout References Mailings Review View A A Aa vA 前、一间刷 一| T AaBbCcDdE AaBE x A Av X, Normal No Spacing Headi co Edit and Save Start your free one month trial of Microsoft 365 or sign in to activate an existing subscription. 9. In human beings, the gene for red-green colorblindness (r) is sex-linked and recessive to its allele for normal vision (R), while the gene for freckles (F) is autosomal and dominant over its allele for nonfreckled (f). A nonfreckled, normal-visioned woman whose father was freckled and colorblind, marries a freckled, colorblind man whose mother was nonfreckled. a. What is the genotype of the woman's father? b. What is the probability that the couple's first child will be a non-freckled, normal visioned girl c. What is the probability that the first two children born to the couple will be freckled and colorblind girls? d. What is the probability that the first child born to the couple will either be a freckled, colorblind boy or a non-freckled,…Titled “Techniques utilized to generate a genetically engineered organism and confirm gene disruption.” a. In the table, indicate with an "x" if the reagent or technique applies to DNA, RNA, and/or protein. You can have more than one "x" in each row or none at all.
- Task A: Polymerase Chain Reaction Master Mix Your first task is to isolate and amplify the NRAS gene from cDNA extracted from different samples through PCR. You will need to run a total of 7 PCRs: 3 normal samples, 3 cancerous samples, and 1 negative control. To make things easier in the lab, when running multiple reactions, the components are prepared not individually, but as a master mix—all the components for multiple reactions are prepared in bulk, except for the template DNA, which is added separately once the master mix has been distributed into individual tubes. The table below lists the different components for PCR, the available stock concentrations of these components, and the needed working concentrations for the PCR itself. Complete the table by supplying the needed volumes of each component for a single reaction and for the master mix (the first row has been filled in as an example).acconline.austincc.edu/ultra/courses/_891351_1/cl/outline O gel electrophoresis O PCR O genomic library DNA microarray A patient is suspected of having a certain type of cancer that involves several genes. Doctors want to determine whether this patient is expressing these cancer genes and to what leve each gene is being expressed. What technique may be used? O molecular cloning O CRISPR gene editing 5 genetic recombination that occurs naturally (think horizontal gene transfer, meioșis, fertilization, or mutations). Ar : Y EV АУ ΩΘΙ 用く X A MacBook Air & 8 88 Q V Ix % 0 8A EXE D B 图 Q 用图 5 d Show All † 19 EHR ImmunizaPlease I want the answer of (B) and (C) Task 1. Your graduate advisor asks you to amplify the following sequence of DNA by PCR: 5’-ATACGCATTCGGACCAGGTCCTAA-3’ 3’-TATGCGTAAGCCTGGTCCAGGATT-5’ a. To ensure that the entire sequence above is amplified, what 6-nucleotide DNA primers should you add to your PCR mix? You order the primers listed above, but instead receive the following set of primers: 5’-CGCATT-3’ 5’-GGACCT-3’ b. What portion of the double stranded DNA molecule will be amplified after 10 rounds of PCR? Your labmate attempts to rescue your PCR reaction by providing you with the following set of primers: 5’-ATACGC-3’ 5’-TCCTAA-3’ c. What is the result of running the PCR reaction with your labmate’s primers? How many double stranded molecules of DNA will result from 10 rounds of amplification?