2. The following is the sequence of a gene encoding a small protein: GG (d) 5' AACGATGCCATCAGAGCCCAGGACGTGATTTAA 3' 3' TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT 5' Ċ (c) a) If transcription proceeds from left to right and begins at the first base shown, what is the sequence of the mRNA from this gene? Label the 5' and 3' ends. AATT

Questions 11-14. Melia and Sophie performed a PCR experiment using DNA purified from their phage Zucchinibread. They did a positive control, a negative control, and an experiment using subcluster B1 primers. They ran a 0.8% gel (shown below). 10KB 3Kb 1Kb 0.5Kb FA 1KB DNA Ladder Negative Control Positive Control Phage DNA+ B1 Primers

Pls can you identify lab F,A,E,B

What is this image and the different parts of it explained?

What is the structure highlighted?The options are the second picture. thank you.

Hi expert please answer both its super easy for you

PART C: CALCULATING THE DIAMETER OF THE FIELD OF VIEW (FOV)_ The field of view (FOV) is the circular area you can see when you look through the microscope. The diameter of the field of view is different depending on which objective lens you are using. For example, you are using the medium-power objective lens, then the area you can see is actually smaller than if you were using the low-power objective lens. Knowing The diameter of the field of view can help you estimate actual size of objects / cells seen through the microscope. When the revolving nose piece is turned to the low power objective lens, a dear plastic ruler can be placed on the microscope stage (see figure 1). Then, the coarse adjustment knob can be used to focus on the millimeter marks of the ruler making sure that one of the milimeter marks is at the left edge of the field of view (see figure 2). NOTE: Slage cip I-1000 Objects in the FOV are usually measured in micrometers (um). To convert, a FOV in mm, times it by 1000…

stain

Which type of cell contorts its cytoplasm and forms the lumen of capillary tubes and microvessels? Edit View Insert Format Tools Table 12pt v Paragraph v BIUA T2

blackboardcdn.com/5bfc08ba3fldc/14683296?X-Blackboard-Expiration=16245468000008X-Blackboard- 19 / 47 100% 1.4. Functions of the light mlcroscope parts Complete the following table by writing the function(s) of each of the parts indicated. Structure Function Diaphragm / iris Stage opehing Lamp Objective lenses Eye piece Coarse and find adjustment knobs Stage Stage rack prt sc delete home backspace lock enter pause t shift