3. Using the below hypothetical character matrix of traits (left column) for these imaginary taxa (top row), choose the most likely phylogeny (a, b, or c), assuming that the Priltezon is the outgroup. Here presence is indicated by yes(Yes), and absence is no (No). Priltezon Frizzle Millispeed Bragoon Tortlouse Catellini Fur no no no No No Yes Eyes no no no no Yes Yes Six arms no no no yes Yes Yes Ears no no yes yes Yes Yes Backbone no yes yes yes Yes Yes b. C. a. P F T M B M B F T P C PMBFCT
Q: Consider this scenario following several generations of frogs and then answer the following…
A: In the context of evolution, the key indicator of evolution occurring is a change in the allele…
Q: An athlete tested positive for Methylhexaneamine in urine with a level of 0.90 µg/mL. At her appeal…
A: In competitive sports, the accuracy and reliability of doping tests are fundamental due to their…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: The objective of the question is to understand the chromosomal condition during the prometaphase…
Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.
A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…
Q: What are our conscious and inadvertent effects on evolution and biodiversity?
A: Intentioned and inadvertently changing biodiversity and evolutionary shapes, human action contains a…
Q: A bacterial culture is initially composed of 100 cells. After 1 hour the number of bacteria is 1.5…
A: The given answer calculates how long it will take for bacterial populations to quadruple in perfect…
Q: developing my and rende hope to prevent C 20- 10 30- Show the quantities of selected vitamins and…
A: The questions below the diagrams are as follows:(i) Explain how the undamaged villi are adapted for…
Q: Which of the following would tend to DECREASE uptake of water by a plant root hair? Increasing the…
A: The question is asking which of the given options would decrease the uptake of water by a plant root…
Q: The most common type of leukemia is: Question 8 options: A) CML.…
A: The question is asking us to identify the most common type of leukemia. Leukemia is a type of cancer…
Q: Which layer(s) of the GI tract is/are made up predominately of connective tissue?
A: Cells are the smallest and most basic functional structure of biological entities. When a group of…
Q: According to Johannes Kepler’s third law, the above planet must be: closer to the sun than the Earth…
A: Kepler's Third Law: the squares of the orbital periods of the planets are directly proportional to…
Q: In the 1960 's the advertisement for a lecture by a whimsical biologist began as follows: "Available…
A: Certainly! Let's break down the advertisement piece by piece:1. "Available now. Linear Motor. Rugged…
Q: Tale Which of the following are determinants of arterial oxygenation? Select all that apply. A) CO2…
A: A) CO2 levels in the blood: The amount of carbon dioxide (CO2) in the blood can affect arterial…
Q: A map of a pond ecosystem
A: An individual or organism carries out all the life processes and is considered a distinct entity. It…
Q: Which of the three phylogenetic trees of the Drosophila species is different from the other two? a.…
A: Approach to solving the question:Carefully observe the 3 trees and find which is different Detailed…
Q: Why do positive feedback systems that are part of a normal physiological response include some…
A: Positive feedback loops are fundamental to physiological processes. This framework is fundamental in…
Q: This form of a food web begins with waste materials and the remains of dead organisms. a. aquatic d.…
A: In ecology, a food web describes the complex network of interactions among various organisms linked…
Q: How is the brain involved in the regulation of body temperature?
A: Maintaining homeostasis within the human body requires the imperative physiological work of…
Q: here in an angiosperm would you find a megasporangium? (A) in the style of a flower (B) enclosed in…
A: The megasporangium, or nucellus, is found interior the ovule in angiosperms. The ovary, a portion of…
Q: A woman exercises at a relatively low-intensity on a treadmill for 1 hour. Her VO¬2 is 1.6 L/min and…
A: When exercising, the body essentially uses carbohydrates and fats as energy sources, the proportions…
Q: In his heliocentric model of the solar system, Nicolaus Copernicus would identify the above planet…
A: Detailed explanation: In Nicolaus Copernicus' heliocentric model, the planet depicted above would be…
Q: . In prokaryotes and eukaryotes, describe what else is happening to the RNA while RNA polymerase is…
A: RNA synthesis, which is carried out by RNA polymerase, maybe a basic movement in both prokaryotes…
Q: Genetics Q1
A: The objective of the question is to calculate the number of DNA sequence copies after 29 rounds of…
Q: Question 1 0.5 pts Which of the following is not one of the 4 main fields of Anthropology? Cultural…
A: 1. Answer:- Modern AnthropologyExplanation:Anthropology is broadly divided into four main…
Q: State and explain 3 factors that affect enzymatic activities
A: Here are 3 factors that affect enzymatic activities and how they influence enzyme function:Substrate…
Q: Genetics Q6
A: The objective of the question is to identify the factor that determines how far DNA will travel from…
Q: 20) Biological control of Salmonella is by using: a) E. Coli (ETEC Strain) b) Shigella c)…
A: 20. Control of Salmonella using Bdellovibrio: Bdellovibrio is a unique predatory bacterium that…
Q: Pregunta 1 (1 punto) ¿Donde se encuentra el banco persistente de semillas? a En el suelo enterradas…
A: 1A) Translation of Spanish Text to EnglishOriginal Spanish Text:La respuesta correcta es a) En el…
Q: Child Obesity (youtube.com) 1.) After watching the video, provide impressions regarding the impact…
A: Approach to solving the question:To effectively address the impact of childhood obesity on the…
Q: which of the following do researchers not need to use during vector cloning? a. a plasmid containing…
A: Certainly! Let's delve deeper into each option:a. Plasmid containing selectable marker genes: When…
Q: When researchers first discovered that airflow through a bird’s paleopulmonal parabronchi is…
A: The respiratory framework of birds highlights a one of a kind instrument for gas exchange, distinct…
Q: RELPs: A. are the same length for mutant and normal beta-globin alleles. b. determine the sequence…
A: Approach to solving the question: Read through each statement carefully and determine which ones…
Q: E2F is a transcriptiion factor that activates genes for DNA rep- proteins. In addition with RBR,…
A: The capacity of a single cell to isolate and create into a whole organism is known as totipotency.…
Q: Water absorption by roots is under the influence of
A: Transpiration is a process through which the loss of water takes place from the exposed parts of the…
Q: Choose all true statements about the difference between translation at free ribosomes versus bound…
A: The question is asking us to identify the correct statements about the differences between free…
Q: GQ16
A: The objective of the question is to identify the correct statement about the biological process of…
Q: How would most biologists and anthropologists explain the reasons behind why primates do specific…
A: Primate behavior is generally understood by scientists and anthropologists to be the consequence of…
Q: Describe at least 3 traits that are different between Old World Monkeys and Apes. Is Curious George…
A: The objective of the question is to identify the differences between Old World Monkeys and Apes, and…
Q: What prevents overinflation of the lungs? partial pressure of oxygen in alveoli…
A: The question is asking about the mechanism that prevents the lungs from overinflating, which could…
Q: Part 2 - Multisystem anatomy - Label the structures indicated in the sagittal abdominopelvic region…
A: provided sagittal section image ofthe abdominopelvic region showcases major anatomical structures…
Q: Which of the following molecules is an inducer of the lac operon: a. Galactose d. Isothiocyanate b.…
A: The lac operon may be a well-studied model of gene control in microscopic organisms, notably E.…
Q: Define about genome-wide association studies (GWAS) ?
A: Genome- Wide Association Study (GWAS) or Whole genome association study (WGAS) is a study of…
Q: What does “descent with modification” mean? a. Populations that change quickly are likely to become…
A: "Descent with modification" is a core concept in evolutionary biology that Charles Darwin…
Q: Calculate the amount of protein (in mg) in Sample 1 if the measurement at A280 = 0.636, taking into…
A: The amount of protein in a sample can be found by using a special machine that measures how much…
Q: What type of mating system developed in Round 1 without male parental involvement? Why? What type of…
A: A) Round 1: Without male parental involvement, the mating system that developed was a promiscuous…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: The objective of the question is to understand the chromosomal condition during the prometaphase…
Q: Part 3 - Label the structures indicated in the transverse abdominal section shown. 2. 3. 1. 4. 5. 6.…
A: Here's a brief overview of each of the anatomical structuresVertebra:Vertebrae are the individual…
Q: 1) Enter a number without the word "tree". ________ 2) Determine the proper numerical value for…
A: To determine the phylogenetic tree using the UPGMA procedure, we need to follow these steps: Step 1:…
Q: What kind of dentition do strepsirhines have? What kind of food do they eat and how do their teeth…
A: Approach to solving the question:1. Define strepsirhines and their dentition.2. Discuss their…
Q: Look at the conditions on the terms and descriptions or definitions on the right. Match each…
A: Here are the matches:species richness: measurement of the number of species presentlow resistance: a…
Step by step
Solved in 2 steps
- Which of the following does not help systematists determine whether a morphological character state is ancestral or derived? a. outgroup comparison b. patterns of embryonic development c. studies of the fossil record d. studies of the character in more related species e. dating of the character by molecular clocks8. Which of the following is problematic when the goal is to construct cladograms that accurately reflect evolutionary history? Group of answer choices shared derived characters homologous characters monophyletic taxa homoplastic characters1. Aside from the provided species concepts, if you are to MAKE YOUR OWN SPECIES CONCEPT, how would you define it? Discuss it and note that it should be your own definition for species concept, not others.
- When systematists study morphological or behavioral traits to reconstruct the evolutionary history of a group of animals, they assume that: a. similarities and differences in phenotypic characters reflectunderlying genetic similarities and differences. b. the animals use exactly the same traits to identify appropriatemates. c. differences in these traits caused speciation in the past. d. the adaptive value of these traits can be explained. e. variations in these traits are produced by environmentaleffects during development.Match the terms with the most suitable description. ______ phylogeny a. similar across many taxa ______ cladogram b. evolutionary history ______ master regulators c. human arm and bird wing ______ convergent evolution d. present in a group but not in its ancestors ______ derived character e. based on neutral mutations ______ molecular clock f. insect wing and bird wing ______ analogous structures g. diagram of .sets within sets ______ divergent evolution h. different lineages evolve in a similar way ______ homologous structures i. closely related lineages evolve in different waysThe phylogenetic tree to the right showsthe evolutionary relationships of taxa A –H. The shapes represent character statetrait changes. A. Which traits (shapes) would individualsin taxa D have? Draw the collection oftraits. B. Is the triangle a synapomorphy orpleisomorphy (circle one)? C. Is the circle a synapomorphy orsympleisomorphy (circle one)?
- Shown above are three possible phylogenetic trees for species I, II and III reconstructed based on the 4-nucleotide DNA sequences given in the righthand table. In every tree, each hatchmark on a branch represents a single base-change event. The most parsimonious tree would be - A. Both X and Y. B. X. C. Y. D. Both Y and Z. E. Z.The table shows the distribution of traits (A-E) in six extant species (1-6). A “0” indicates the ancestral condition, and a “1” indicates the derived condition. 1. Which trait is least informative of phylogenetic relationships within the group? 2. Which species has the fewest number of derived characters?1. I have found a heritable, morphologic trait that I think is phylogenetically informative. Before I use this data to construct a cladogram, I must ensure the trait possesses some key features. What features must this trait have? Morphological trait must have 3 thin. 1. it must be heritable2. it must be a quantitative3. ? Question 1, I just need to know the Morphological trait must have heritable and quantitative and what 2. You have two traits that you could use to reconstruct evolutionary relationships: One is fur color, and the other is a coding sequence for a gene (agouti) that influences fur color. What type of data/trait is fur color; what type is gene coding sequence? Identify which trait is likely to be more phylogenetically informative and explain your reasoning. My answer: coding sequence of the fur color is more important and informative for fur color trait as it will informative to find out evolutionary information based on coding sequence and find out common…
- 1. What is phylogeny? Why is it considered an important field in understanding evolutionary processes? 2. What is the difference between allopatric from sympatric speciation?4. Which of the following is an example of convergent evolution? Group of answer choices a. A population of finches becomes separated in the Galapagos Islands and begins to develop into two different species of finch b. Two different species of plants in separate deserts evolve a similar waxy outer cuticle to preserve water c. One species of lizard evolves a green coloration to blend in with its tropical forest surroundings, whereas another species evolves a tan coloration to blend in with its desert surroundings d. Because they share a recent common ancestor, Lions and Bengal Tigers both have retractable claws for catching prey e. Melanic moths begin to lose pigment in their wings as the environment becomes less polluted 6. Which of the following scenarios is an example of stabilizing selection? Group of answer choices a. A population of sharks is evolving towards the average body size; small sharks fall prey to killer whales, large sharks can't get…The principle of parsimony a. helps evolutionary biologists distinguish among competing phylogenetic hypotheses. b. does not require that the polarity of traits be determined. c. is a way to avoid having to use outgroups in a phylogenetic analysis. d. cannot be applied to molecular traits.