6.26 LAB: Exact change - functions Write a program with total change amount as an integer input that outputs the change using the fewest coins, one coin type per line. The coin types are dollars, quarters, dimes, nickels, and pennies. Use singular and plural coin names as appropriate, like 1 penny vs. 2 pennies. Ex: If the input is: 0 or less, the output is: no change Ex: If the input is: 45 the output is: 1 quarter 2 dimes Your program must define and call the following function. The function exact_change() should return num_dollars, num_quarters, num_dimes, num_nickels, and num_pennies. def exact_change(user_total) Use Python, please.

6.26 LAB: Exact change - functions Write a program with total change amount as an integer input that outputs the change using the fewest coins, one coin type per line. The coin types are dollars, quarters, dimes, nickels, and pennies. Use singular and plural coin names as appropriate, like 1 penny vs. 2 pennies. Ex: If the input is: 0 or less, the output is: no change Ex: If the input is: 45 the output is: 1 quarter 2 dimes Your program must define and call the following function. The function exact_change() should return num_dollars, num_quarters, num_dimes, num_nickels, and num_pennies. def exact_change(user_total) Use Python, please.

C++ Programming: From Problem Analysis to Program Design

8th Edition

ISBN:9781337102087

Author:D. S. Malik

Publisher:D. S. Malik

Chapter3: Input/output

Section: Chapter Questions

Problem 12SA: 12. What is the output of the following program? (2, 3, 6, 8) #include <iostream> #include...

See similar textbooks

6.26 LAB: Exact change - functions

Write a program with total change amount as an integer input that outputs the change using the fewest coins, one coin type per line. The coin types are dollars, quarters, dimes, nickels, and pennies. Use singular and plural coin names as appropriate, like 1 penny vs. 2 pennies.

Ex: If the input is:

or less, the output is:

no change

Ex: If the input is:

the output is:

1 quarter 2 dimes

Your program must define and call the following function. The function exact_change() should return num_dollars, num_quarters, num_dimes, num_nickels, and num_pennies.

def exact_change(user_total)

Use Python, please.

LAB
6.26.1: LAB: Exact change - functions
0/ 10
АCTIVITY
main.py
Load default template.
1 # Define your function here
2
з if
main_':
name
input_val = int(input())
num_dollars, num_quarters, num_dimes, num_nickels, num_pennies = exact_change (input_val)
==
7
# Type your code here.

Process by which instructions are given to a computer, software program, or application using code.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps with 5 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

9.5.1: Use the addChoice method to add any needed instance variables. Provide a different implementation of ChoiceQuestion. Instead of storing the choices in an array list, the addChoice method should add the choice to the question text. For this purpose, an addLine method has been added to the Question class. ChoiceQuestion.java: /** A question with multiple choices.*/public class ChoiceQuestion extends Question{ // Add any needed instance variables, but don't store the choices // The choices should be added to the text of the superclass /* Your code goes here */ /** Constructs a choice question with a given text and no choices. @param questionText the text of this question */ public ChoiceQuestion(String questionText) { /* Your code goes here */ } /** Adds an answer choice to this question. @param choice the choice to add @param correct true if this is the correct choice, false otherwise */ public void…
Using Dr-Racket, what is the purpose of the number function?(define (number n)(local [(define (abstract int)(* int 11))] (build-list n abstract))) A) Create a list of the first n multiples of 11 starting at 11. B) Create a list of the first n multiples of 11 starting at 0. C) Create a list of the first n multiples of 11 starting at 1. D) Create a list of the first 11 multiples of n starting at 1. E) Create a list of the first 11 multiples of n starting at 0.F) Create a list of the first 11 multiples of n starting at n.
During the sockets lab we cast the second parameter from a struct sockaddr_in to a struct sockaddr. struct sockaddr_in address; /* ... */ bind(server_fd, (struct sockaddr*)&address, sizeof(address)) This provides a limited form of polymorphism: bind only needs the first few fields of its struct, and both struct sockaddr_in and struct sockaddr have the same fields at those addresses. Consider the following example: typedef struct { float x; float y; float z; } point3D; typedef struct { float x; float y; } point2D; float distance(point2D *a1, point2D *a2) { /* ... */ } int main() { point2D a = { .x = 2.1, .y = 3.0 }; point3D b = { .x = 4.1, .y = 4.3, .z = 4.0 }; // Call distance function with a and b } How would you pass a and b to the distance function? If several work, pick one that will not create warnings. A. distance(a, b); B. distance(a, (point2D)b); C. distance(&a, &b); D. distance(&a, &(point2D)b); E. distance(&a, (point2D*)&b); F. none of…
#include <stdio.h>#include <stdlib.h>#include <unistd.h>#include <sys/types.h>#include <sys/wait.h> int main(){ int i, s; int a[] = {23,4,8,33,25,7,12,6,49,50,11,20,21,24,35}; pid_t pid; pid = fork(); if (pid == 0) { printf("I'm a child, I'll be printing the even numbers:\n"); for(i=0;i<(sizeof(a)/sizeof(int));i++) if(a[i]%2 == 0) printf("%d ",a[i]); } else { printf("I'm the parent, I'll be printing the odd numbers:\n"); if (pid > 0) pid = waitpid(pid, &s, 0); for(i=0;i<(sizeof(a)/sizeof(int));i++) if(a[i]%2 != 0) printf("%d ",a[i]); } return 0;} the output seem to have some error whereby it cannot output the number for the first if
Consider the following C++ code fragment: int a = 3; int b = 2; double r = a/b; Suppose we want r to have the value 1.5, rather than 1. Which cast operator can be used in the third line to achieve this effect? a. static cast b. dynamic cast c. reinterpret cast d. none of the above
In this final submission, you will build on checkpoint B to load the database and DNA sequence from files. There will be two databases and several sequences that will be available for download below. Example of the database is the file small.txt: name,AGATC,AATG,TATC Alice,2,8,3 Bob,4,1,5 Charlie,3,2,5 Example of the sequence is the file 1.txt: AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG Implement/modify the following functions: Modify the function readData, which will now take an additional parameter: a string representing the filename containing the database of individuals and their STR counts. It will also return a bool indicating if opening the file was successful or not: bool readData(string filename, vector<string>& nameSTRs, vector<string>& nameIndividuals, vector<vector<int>>& STRcounts) Update the function…
21.2 Project 1 (Checkpoint B): DNA Write the full C++ code for this Implement the following functions: /** * Reads from standard input a list of Short Tandem Repeat (STRs) * and their known counts for several individuals * * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @param nameIndividuals the names of individuals (eg. Alice, Bob, Charlie) * @param STRcounts the count of the longest consecutive occurrences of each STR in the DNA sequence for each individual * @pre nameSTRs, nameIndividuals, and nameSTRs are empty * @post nameSTRs, nameIndividuals and STRcounts are populated with data read from stdin **/ void readData(vector<string>& nameSTRs, vector<string>& nameIndividuals, vector<vector<int>>& STRcounts) For example, consider the input: 3 AGAT AATG TATC Alice 5 2 8 Bob 3 7 4 Charlie 6 1 5 In the first line, the number of STRs followed by the names of those STRs, which will be populated into the vector nameSTRs. The remaining lines contain…
bubblesort.h is in second picture This is bublesort.c int compare(Entry a, Entry b) {// IMPLEMENT}/*TEST: ./mergesort < test.inOUTPUT:1 lsdfjl2 ghijk3 ksdljf5 abc6 def*/int main(void) {// IMPLEMENT} this is test.in 55 abc6 def2 ghijk3 ksdljf1 lsdfjl
4.10.1: LAB: Exception handling to detect input string vs. integer The given program reads a list of single-word first names and ages (ending with -1), and outputs that list with the age incremented. The program fails and throws an exception if the second input on a line is a string rather than an integer. At FIXME in the code, add try and except blocks to catch the ValueError exception and output 0 for the age. Ex: If the input is: Lee 18 Lua 21 Mary Beth 19 Stu 33 -1 then the output is: Lee 19 Lua 22 Mary 0 Stu 34 # Split input into 2 parts: name and ageparts = input().split()name = parts[0]while name != '-1': # FIXME: The following line will throw ValueError exception. # Insert try/except blocks to catch the exception. age = int(parts[1]) + 1 print('{} {}'.format(name, age)) # Get next line parts = input().split() name = parts[0]
Java 1. Need a list of 30 words, phrases and company names commonly found in phishing messages. Assign point value to each based on your estimate of its likelihood to be in a phishing message (e.g., one point if it's something likely, two points if modereratly, or three points if highly likely). Do an application that scans a file of text for these terms and phrases. For each occurance of a keyword or phrase within the text file, add the assigned point value to the total points for the number of occurences and the point total. Show the point total for the entire message. 3. Do a word file answering these questions:Does your program assign a high point total to some actual phishing e-mails you have received? Does it assign a high point total to some legitimate e-mails you have received?
1. Build a web crawler function that starts with a URL representing a topic (a sport, your favorite film, a celebrity, a political issue, etc.) and outputs a list of at least 15 relevant URLs. The URLs can be pages within the original domain but should have a few outside the original domain.
please code in python Write a function called weighted_avg that takes a list of grades and a corresponding list of weights and returns the weighted average of the grades rounded to 1 decimal place. Your function should raise an exception with the message exactly as shown: a weight is less than 0 or greater than 100 (message: "A weight is less than 0 or greater than 100") the weights do not add to 100 (message: "Weights do not add to 100") the number of weights and grades are not equal (message: "The number of weight and grades are not equal") a grade is below 0 (grades above 100 would be considered extra credit and are acceptable) (message: "A grade is below 0") Do not print the exception just 'raise' it. Run your function on grades1 with weights1 and grades2 with weights2 and grades3 with weights3 and grades4 with weights4, defined below. Catch the errors generated in each case as an exception with the useful message for the user as defined above. Hint: The first 3 test cases should…