Beta sheets shown in the figure below are: "" Parallel Not enough information One strand is parallel and another is anti-parallel Anti-parallel

Show the separation pattern of the following DNA molecules on 1 % agarose gel. Justify your results. 5 kbp 5 kbp 5 kbp 5 kb +

5'-GCGGTACGTTACGGCTTTACTGACCTGCAGGC-3' A. Convert this to a double strand DNA molecule by writing the complementary sequence. Be sure to correctly label the ends of the double stranded molecule B. Pick one of the two strands and write the sequence of an RNA molecule that could be transcribed from it. Again, you must correctly label the ends of the molecule.

Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )

Match the strands (W - Z) to their role in replication (leading or lagging) 3' ||| 5 W Leading A. В. lagging z in

8