A researcher performed agarose gel electrophoresis on a mixture containing 3 DNA strands: (1) GGTTCATTACACGACTAGCATTCTCTACTA (2) ATATATATATATATA (3) GGGCACACA In which of the gels below are the bands properly labeled? A В C E (3) (3) (2) (1) (2) |(1) (1) (3) (+) (3) (1) (2) (3) (2) OD O E 1) B. OOOC

A researcher performed agarose gel electrophoresis on a mixture containing 3 DNA strands: (1) GGTTCATTACACGACTAGCATTCTCTACTA (2) ATATATATATATATA (3) GGGCACACA In which of the gels below are the bands properly labeled? A В C E (3) (3) (2) (1) (2) |(1) (1) (3) (+) (3) (1) (2) (3) (2) OD O E 1) B. OOOC

Introduction to General, Organic and Biochemistry

11th Edition

ISBN:9781285869759

Author:Frederick A. Bettelheim, William H. Brown, Mary K. Campbell, Shawn O. Farrell, Omar Torres

Publisher:Frederick A. Bettelheim, William H. Brown, Mary K. Campbell, Shawn O. Farrell, Omar Torres

Chapter23: Enzymes

Section: Chapter Questions

Problem 23.33P

See similar textbooks

Similar questions

5 ased on molecular weights of purified (no beta-Me) and (beta-Me) sample, which are 97.4 kDa and 47.2 kDa, what can be said about the number and size of the protein monomers, as well as the nature of the bonds holding together the complete quaternary structure of the proteins?
Question 2. While internal cysteine amino acid sidechains in proteins undergo oxidation to produce disulfide crosslinks that stabilize the protein structure after folding, solvent-exposed cysteine sidechains can remain in their reduced thiol form and serve as reactive nucleophiles (recall for instance Acyl Carrier Proteins involved in fatty acid biosynthesis or various oxidoreductase enzymes). The reactive thiol groups in proteins can be detected using Ellman's test, wherein the protein is reacted with a disulfide Ellman's reagent to form a new mixed disulfide and a 2-nitro-5-thiobenzoate (TNB) byproduct. Upon addition of base, TNB is deprotonated to form a dianion, which absorbs light in the visible region and can be detected using UV-Vis spectroscopy. Ellman's Reagent CO₂H -NO₂ internal disulfide crosslink O₂N- HO₂C SH solvent- exposed thiol UV Absorbance at 412 nm O₂N- -S TNB²- alkaline pH O₂N- SH HO₂C 2-nitro-5-thiobenzoate (TNB) -NO2 mixed disulfide CO₂H a) Provide a detailed…
When the relaxivity of a Gd-based magnetic resonance agent is high, this means that slight changes in Gd concentration result in only slight changes in magnetic resonance contrast. * O True O False
Use the values provided below to calculate the predicted isoelectric point, pl, value for aspartame. HO NH2 NH2 phenylalanine aspartic acid pКа1 а-СООН%3D 1.83 pKa2 a-NH3* = 9.13 pКa1 а-СООН %3D 1.88 pKa2 a-NH3* = 9.60 pKa3 side chain-COOH = 3.65 %3D
Two phenylalanine residues are separated by 1.0 nm in a polypeptide. Calculate the dispersion interaction (kJ×mol-1). (a = 1.0 ´ 10-29 m3) I = 500 kJ×mol-1 ( ) -0.204 ( ) -0.133 ( ) -0.0688 ( ) -0.0375 ( ) -0.0233
What are two ways to measure the total amount of all proteins in a purification sample? O 1) Calculating the yield and 2) calculating the purity of a purification. O 1) Measuring absorbance at 280 nm and 2) using an enzymatic assay for your protein of interest. O 1) Quantitating the amount of your protein of interest using binding of a labeled antibody (e.g.. an ELISA) and 2) using a dye-binding assay. O 1) Measuring absorbance at 280 nm and 2) using a dye-binding assay.
Shown below is a section of beta-sheet from the protein thioredoxin. Amide nitrogens are indicated by circled Ns, carbonyl oxygens by Os, and hydrogen bonds by gray lines. M strand 1 MO strand 3 (N) O 1 2 3 4 For each strand of the sheet (1, 2, 3, 4) indicate the direction (top or bottom) of the N-terminus. [Select] strand 2 [Select] O [Select] strand 4 [Select] strands 1 and 2 Determine the orientation (parallel or antiparallel) of each adjacent strand to one another. [ Select] AHO strands 2 and 3 [Select] N strands 3 and 4 [Select] >
macollege.instructure.com/courses/352/pages/covid-proteins-lab-manual?module_item_id=D44333 A = abc Where "A" is absorbance, "a" is molar absorptivity, "b" is the path length (length of the cuvette in units of cm), and "c" is concentration (mol/L). The molar absorptivity is an intrinsic property of a molecule which tells us how intensely it will absorb at a particular wavelength. If "A" is a unitless quantity, "b" is in units of cm, and "c" is in units of mol/L, then what are the units of molar absorptivity? Do a little research to learn how alpha-helices and beta-sheets are drawn in protein structures. If most of the absorption properties are coming from the alpha-helices in these proteins, and many alpha-helices have similar absorbance properties across different proteins, which protein would you predict would have the highest molar absorptivity? Your job is to use the following data table to determine the molar absorptivity for each of the following proteins at their respective…
A protein consists of two types of peptide chains (A and B) with an unknown stoichiometry (AxBy). When you ran this protein directly on reversed phase-HPLC with UV monitor set at 280 nm, two peaks were resolved. Mass spec determined that the peaks represented Chain A and Chain B, respectively. The peak area is 500,000 for Peak A (Chain A) and 100,000 for Peak B (Chain B). The molecular masses of Chain A and Chain B are 25,000 and 5000, respectively. The extinction coefficients for Chain A and Chain B are 1 mL/mg.cm and 0.5 mL/mg.cm, respectively. Please calculate x/y.
Chemistry Find peptide RKCSPDD charge at 1, 7, and 14 ph
The electrospray ionization mass spectrum of the tripeptide Ala-Met-Thr shows peaks of mono-protonation and di-protonation of the tripeptide. At what values of m/z would these peals be expected? Briefly explain and show your workings.
Most of the ultraviolet absorption of proteins at 280 nm is due to their content of a. Glutamate b. Tryptophan c. Alanine d. Aspartate