Answered: Discuss the 4 components of Medicare.…

Discuss the 4 components of Medicare. Where are these 4 components applicable and why is it important to know this information?

Understanding Health Insurance: A Guide to Billing and Reimbursement

14th Edition

ISBN:9781337679480

Author:GREEN

Publisher:GREEN

Chapter15: Medicaid

Section: Chapter Questions

Problem 7R

See similar textbooks

Related questions

Q: multicellular organisms, nondividing cells stay in G0 phase. For the cell, why is it better to be he...

A: Cells first enter into the G0 phase from a cell cycle checkpoint then in the G1 phase, there are som...

Q: Discuss the benefits and risks of three prenatal diagnosismethods

A: Prenatal diagnosis is referred as a set of procedures run before the delivery of the child. It is do...

Q: Which among the processes below will be used during heat defense? vasodilation and thermogenesis O s...

A: vasodilation work against heat as sweating does When heat produce in body to balance the body tempe...

Q: Which of the following is a type of gene transfer that is NOT species-specific? O conjugation O tran...

A: Answer 5:- Transduction is a process in which the virus transfers genetic material to the cell. Here...

Q: Marfan syndrome (Section 13.5) is inherited in an autosomal dominant pattern. What is the chance tha...

A: Introduction:- Marfan syndrome is a connective tissue disorder caused by a genetic mutation. Mutatio...

Q: The two basic requirements, needed for studying the type of protein synthesis and intercompartmental...

A: Palade and colleagues' study detected the location of newly synthesized amino acids by labeling them...

Q: Please help me answer how much volume of cell suspension needed (for 5*10^4 cells) in microliters. P...

A: For some experiments, it is essential to use the specified number of cells of microbes (or otherwise...

Q: 5

A: Recombinant forms of Oestrogen and Progesterone are used in post menopausal women. Recombinant insul...

Q: in your own words, please describe the squash and the squash soup

A: Squash:- Squash is a kind of vegetable in a family of plants that comes in several different types, ...

Q: Outline the flow of genetic information in cells, from DNA to RNA to polypeptide.

A: DNA is the genetic material present in the cells.

Q: Evolution______ . a. is change in a line of descent b. is the same as natural selection c. is the go...

A: Different patterns are associated with evolution and such patterns help in categorizing evolution in...

Q: Match the sense orgs with the type of stinulus they are able to detect Ooo mouth (Choose) ight chemi...

A: Stimulus(plural)/Stimuli(Singular) Any change in an organism's environment that causes to the organi...

Q: Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical pro...

A: ANSWER;- Forward primer:Sequence = 5'-CT-GAATTC-ATGGCTAAAGGCGGAGCT-3'Length = 18 ntdGC content = 56...

Q: Based on the information above, what can you speculate about the possible evolution of the genes tha...

A: Rab proteins are small GTP-binding proteins within a superfamily of GTPases known as the Ras superfa...

Q: NAD+ b. Pyruvate

A: Fermentation is a well stated to been supposed to define as is a metabolic process that involves the...

Q: List the four main types of organic compounds found in living systems, and identify which of these a...

A: All the living organisms are made up of cells and each and every cell of the body is made up by a or...

Q: How does the vegetal stratification of an ecosystem influence its biological diversity?

A: Stratification in the field of ecology refers to the vertical layering of habitat. The arrangeme...

Q: Density independent or Density dependent Situation Limiting factor 4. Super typhoon Yolanda caused m...

A: Biological population can be controlled by biological factors or by the the physical or or chemical ...

Q: A set of cells that host various DNA fragments collectively representing an organism’s entire set of...

A: DNA molecules are present in the cells of living beings and regulate the genetic traits.

Q: (a)Describe the small intestine epithelia cells observed under HPO in microscope. (b) Describe the k...

A: In small intestine mainly simple columnar epithelium and in kidney simple cuboidal epithelium is fou...

Q: Compare the structures of DNA and RNA.

A: Nucleic acids are the most important organic compounds found in all living beings. The three major c...

Q: In order to view Treponema pallidum, the causative agent of syphilis, under the microscope, you can ...

A: Treponema pallidum is the causative agent of sexually transmitted disease (STD) called syphilis.

Q: a) Provide a description of the the small intestine epithelial cells observed under high power objec...

A: Histopathology:- Small Intestine Mucosa: - Type of Lining: - Simple Columnar Epithelium Morphology:-...

Q: 2. Draw a Punnett square of a cross between a homozygous dominant individual and a heterozygous indi...

A: Answer 1: - Parent individuals: - BB (homozygous dominant), Bb(heterozygous dominant) Cross: - ...

Q: Dinosaurs like protoceratops how do they defend themselves from predators like velociraptors or othe...

A: Dinosaurs like protoceratops how do they defend themselves from predators like velociraptors or othe...

Q: expalin how theory of evolution affects our view of the origin, developtment and spread of new disea...

A: The theory of evolution is based on the idea that all species are linked and evolve through time. Th...

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...

A: Here, human DATP gene sequence of human is given , i.e : ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: How are enzymes classified? What are the different classes of enzymes?

A: Enzymes are biocatalyst that is proteinaceous in nature and perform a specific type of chemical reac...

Q: are venules blood reservoirs ?

A: At any resting point of time, Venous System is said to occupy 70% of the total circulating blood vol...

Q: A.If the diploid human chromosome number (2n) =46, what will be the chromosome number per cell in ea...

A: Meiosis is the cell division process that involves division of a diploid (2n) mother cell and produc...

Q: Describe the various post-translational modifications of HIF- 1alpha and how it affects the regulati...

A: Describe the various post-translational modifications of HIF- 1alpha and how it affects the regulati...

Q: Domestic cats and dogs and other domesticated animals have they shown any signs of evidence of evolu...

A: Domestication is an evolved trait in which animals are selectively bred and experience significant m...

Q: What would be affected if the globular head of myosin was misshapen? a) The ability to bind to acti...

A: Myosin is a protein, but specifically, a motor protein and a fibrous globulin of muscle that can spl...

Q: An individual’s unique set of_______ can be used in DNA profiling. a. DNA sequences c. SNPs b. short...

A: Introduction In the genome, there is usually two types of nucleic acid sequence present. One is Non...

Q: 8. Another unique feature of coronaviruses is usage of a -1 ribosomal frameshift. Explain this frame...

A: Defination- Ribosomal frameshifting is a biological phenomenon that occurs during translation that r...

Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...

A: Physical features of Aedes aegyptiAedes aegypti is a small, dark mosquito that mosquitoes are distin...

Q: Question: How has having an opossable time thumb helped primates, especially humans to adapt to th...

A: Having an opossable time thumb helped humans especially to adapt to their environment and better su...

Q: A molecule of composition5′-AAAAAAAAAAA-3′3′-TTTTTTTTTTTTT-5′is replicated in a solution containing ...

A: Atoms with unstable nuclei regain what is supposed to describe as they are about to define stability...

Q: H* ions generated by reactions in the electron transport chain, as well as H* ions present in the ma...

A: The electron transport chain is a series of reaction in four protein complexes, taht creating an el...

Q: During which decade were there the most contributions leading to the understanding of DNA?

A: Rosalind Franklin made an essential commitment to the revelation of the twofold helix design of DNA,...

Q: What goes into the reaction tube for Sanger sequencing? Template DNA, primers, DNA polymerase, an...

A: Sanger sequencing was developed by Frederick Sanger and his colleagues in the year 1977 to determin...

Q: Give the similarities and differences of plants and animals in terms of its: Reproduction, developme...

A: There are lot of differences between plants and animals. The first and foremost difference between p...

Q: Which Class I element has likely experienced the greatest accumulation of mutations compared to its ...

A: Transposable elements are the Jumping genes which are the mobile genetic material within the genome....

Q: 3. Repeat steps I and 2 for an ear of corn that is the result of crossing Homozygous dominant and he...

A: Mendelian inheritance, or Mendelism, is a collection of hereditary notions proposed in 1865 by Grego...

Q: interaction between cells and their environment

A: Answer :- Cells incorporate signs from their outside and intracellular climate into essential cycles...

Q: Ebola virus kills 90% of the people infected. In an infected individual, how many copies of Ebola Vi...

A: The usual concentration of Ebola in patient's blood is 5-10 X 106 virus particles/ mm3. Major organs...

Q: Explain how FRET could be used to monitor the association of Gαs and adenylyl cyclase following acti...

A: How does fret, a sort of fluorescence can be utilised to essentially check Its interaction of the Ga...

Q: Question 2 KEY #100 O Normal female Normal male Carrier female Female with disorder Male with disord...

A: *A carrier male is married to a normal male and they have two children with having One diseased ma...

Q: What are helicases and topoisomerases?

A: Enzymes are the proteins present in the cells and have catalytic powers.

Q: What is the difference between a mesoderm and a mesoglea?

A: Diploblastic animals contain body wall which develop from 2 embryonic germ layer - ectoderm and ...

Concept explainers

Clinical Pharmacology

Pharmacology is a discipline of medicine that studies how medications interact with the systems and processes of living organisms, focusing on drug action mechanisms as well as therapeutic and other purposes.

Question

Discuss the 4 components of Medicare.

- Where are these 4 components applicable and why is it important to know this information?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Medicare reimbuses ASCS at of their pre-determined rate. 100% B 20% c) 50% 80% Question 38 A feature of the MSN is that countries are expected to pay out-of-pocket payments. A) True False
What is a medication error? How does the bar coding technology minimizes this errors? Site at least 5 benefits of using bar coding in health care system and kindly explain each.
1. What is a yellow prescription? 2. What are the drugs that requires yellow prescription prior to dispensing? 3. Yellow prescription is usually in triplicates. Determine the three recipient of yellow prescription. a. Green - ?? b. White - ?? c. Yellow - ??
9) State three (3) important information that must be included in the referral and list any three situations when a referral is needed?
16-) Which of the following statements about Diagnosis-Related Groups (DRGS) is false? DRGS are used to standardize prospective payments by applying the formula "payment - case weight x adjusted payment rate", where the case weight represents the relative cost of a case in the DRG classification system and the adjusted payment rate converts that weight into a monetary value. Prospective payments calculated through DRGS are a way of introducing supply-side cost sharing. MS-DRGS stands for Medicare Severity-Diagnosis-Related Groups. They are the DRG classification system used by Medicare since 1983 to calculate prospective payments. There are over 750 MS-DRGS and each is assigned a relative weight to approximate the resource usage of the average case within that diagnosis category. Roughly speaking, MS-DRGS are similar to another classification system used by Medicare called Resource- Based Relative Value Scale (RBRVS). In fact, the MS-DRG classification system is used to calculate…
Amir Yazdani is being assessed in the orthopaedic preadmission clinic 6 weeks prior to a knee arthroplasty. He asks to donate some of his own blood to ensure he doesn't receive a transfusion from a stranger. How would you respond to Amir's request? Explain to Amir that there is no chance he will require a blood transfusion, so predeposit autologous donation is not indicated in his specific situation Explain to Amir that predeposit autologous donation is only recommended for patients that are likely to refuse a transfusion and discuss if he would be willing to accept donated blood Explain to Amir why predeposit autologous donation is not recommended, including that it may increase the chance of him requiring a transfusion, and that it does not reduce all the risks associated with transfusion Predeposit autologous donation is an excellent strategy to reduce the risks associated with transfusion. Provide Amir with a referral to enable him to have his blood collected one month prior to…
Research has shown that lifestyle behaviors, dietary, environmental factors, and occupational exposure contribute to the number of heart disease cases and deaths. It is apart from the genetic factors. Describe the difference between modifiable and non-modifiable risk factors and give 3 examples of each.
What are some benefits and challenges of targeting angiogenesis? What are different ways we can target it, and what approach is most effective?
1) Explain the principle of the electrical impedance cell counting. 2) State 3 Haematology analyzer and their manufacturers. 3) CV for automated instrument is +/- 1% to +/- 2% compared to manual count with CV +/- 10%. Can you explain their differences?
Q. What is the difference between blood type and blood group. Person with what blood type can be a universal recipient ? Explain. Person with what blood type can be a universal donor? Explain. Explain, what is Bombay phenotype? Edit View Insert Format Tools Table 12pt v Paragraph |BIUA
There are two special populations that require extra consideration when you are calculating medication dosages. These are pediatric (children) and geriatric (mature adult) patients. Generally speaking, pediatric patients are under the age of 18, and geriatric patients are 65 and over. Explain the factors impacting dosing and medication administration to these patients. Additionally, explain how a patient's weight influences their dosage.
Under what circumstances might genetic screening for mutations be useful in evaluating the risk of HCM