Q: Let's assume that there is an epiallele in mice that causes their fur to become purple. The…
A: It is defined as a particular methylation pattern that occur in a specific genetic locus. It tells…
Q: Compare and contrast the different experiments of Redi,Needham,Spallanzani and Pasteur on the origin…
A: Origin of life has many theories with various interpretation. Each and every theory differs from one…
Q: I have seen that this was answered as C, Why is the answer C, how is that not evidence of it being…
A: Every day, individuals all around the world fail to see the negative impact that alcohol misuse may…
Q: From the perspective of the cell receiving the message, the three stages of cell signaling are O the…
A: Cells can communicate with one another through chemical and mechanical signals. *In multi cellular…
Q: Which best describes the mode of inheritance of the afflicting allele in the following pedigree?
A: The branch of biology that deals with the study of genes, heredity and genetic variations and…
Q: What are the main pathogens that cause pneumonia? detail explanation give every pathogen which…
A: An illness called pneumonia causes the air sacs in one or both lungs to become inflamed. The air…
Q: Fatty acids are catabolized by a process called beta-oxidation. One of the products of beta-…
A: Cellular respiration is a series of metabolic reactions that occur within cells to convert…
Q: Match each of the terms in the left with the best-fitting process in the right column promoter rho…
A: Introduction Making an RNA copy of a gene's DNA sequence is a process known as transcription in the…
Q: (d) Suggest one method to treat Helicobacter pylori infection.
A: A gram-negative, microaerophilic spiral bacterium called Helicobacter pylori, formerly referred as…
Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…
A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…
Q: 6. Sequencing of the heterochromatic regions of the Drosophila genome indicates that within 20.7 Mb,…
A: On the basis of differing staining characteristics, heterochromatin and euchromatin were initially…
Q: Young Saguaro Cacti Under Another Plant Not Under Another Plant Total At your study site in the…
A: When the sample sizes are large, a chi-squared is a type of statistical hypothesis test employed in…
Q: Does the Solute inside or outside the cell?
A: Introduction When two solutions are next to one another and are divided by a semipermeable…
Q: Quadrat-Based Estimates The simplest description of a plant community in a habitat is a list of the…
A: abundance is the relative representation of a species in a particular ecosystem. It is usually…
Q: 1 a. explain briefly, Insects and freshwater fish are both categorized as animals. Describe how the…
A: 1 a. The respiratory system's principal job is to eliminate carbon dioxide and give oxygen to the…
Q: Your cousin is embracing a sugar-free lifestyle and has made sugar-free jam. Canned food that is low…
A: Clostridium is a genus of bacteria that can cause a variety of diseases, including tetanus,…
Q: will it affect much or less?
A: The Bradford assay is measured at 595nm in spectrophotometer.
Q: The energy for the production of ATP comes from the breakdown of a glucose molecule via many…
A: Oxidative Phosphorylation is the process of formation of ATP and it is the final step of cellular…
Q: What is the Shannon diversity index value for this community? What is the Species evenness…
A: Shannon diversity index (H) is given by negative of the sum of pi*ln pi and the species evenness (J)…
Q: Use your knowledge of population growth models to evaluate the spread of Covid-19 in the world…
A: Depending on particular environmental factors, two different patterns of population expansion may…
Q: How do each of the classes of Echinoderm feed?
A: The phylum echinoderms include organisms with larvae that are bilaterally symmetrical. Here, adults…
Q: Manipulated? Measured? B. EFFECT OF TEMPERATURE ON THE RATE OF ENZYME REACTION a. Procedure 1.…
A: The amylase is the enzyme that converts the starch to maltose and hence in the experiment will keep…
Q: Which coat protein is involved in transport of vesicles from the trans-Golgi network to the plasma…
A: Introduction Proteins are huge, complex molecules that play a number of important tasks in the human…
Q: 2. Howler Monkeys - National Geographic: https://www.youtube.com/watch?v=REPoVfN-Ij4 Questions:…
A: Howler monkeys are the largest group among the new world monkeys.These monkeys are famous for loud…
Q: For this plant with binomial name Ixora coccinea L., What is the reference to the original…
A: Ixora coccinea is a dense, multi-branched evergreen shrub that typically grows to a height of 4-6…
Q: 2. Over many generations, the average length of necks in a giraffe population will increase…
A: Introduction Evolution refers to the change of characteristics of a population that can be inherited…
Q: Chains of nucleic acids have directionality and are read in a certain way just like languages are…
A: DNA is the molecule that carries genetic information and is found in nearly all living organisms. It…
Q: conveys the most accurate information. i. Information in the histogram in panel (a) may be used to…
A: From given data it is estimated that heritability of traits ,the increment in the tail of rat is…
Q: compare and contrast how GPCRs and RTKs transduce their signal to the cell? include the types of…
A: Receptors are the protein molecules present either on the surface of a cell or inside the cell,…
Q: In horses, black coats and trotting gait are dominant while the recessive alleles are white and…
A: As the back coats and trotting gait are dominant, let us take them as B and T. 1. Since the male is…
Q: Which is NOT ALWAYS true about nematodes? They have a cylindrical body. O They have longitudinal…
A: Introduction The nematodes come under the phylum Nematoda and are called roundworms. They have…
Q: Why is variation advantageous to populations? How does this relate to species that reproduce…
A: Reproduction is a phenomenon of fusion of two gametes and formation of zygote . It is a…
Q: What do you think about the hypothesis that language evolved as a way for early hominins to…
A: Introduction:- The technological hypothesis proposes that gestural language evolved in early…
Q: 3- Ontario estern gray frog (Hyla versicolor) is an example of...........species, which is a type…
A: Introduction:- The term, ploidy is used for the number of sets of chromosomes within an organism.…
Q: a skeletal muscle cell has depleted its stores of ATP how will the altered transport properties of…
A: Skeletal muscle is one of the three significant muscle tissues in the human body. Each skeletal…
Q: hypothalamus thyrotropin-releasing hormone (TRH) inhibition inhibition anterior pituitary…
A: Correct option is d A decrease in thyroxine level means a loss of inhibition to hypothalamus and…
Q: Suppose you are a production manager of a pharmaceutical company, now you are assigned to formulate…
A: The world's biggest preventable reason for death is tobacco usage, which results in cigarette…
Q: (b) Compare the modes of transmission of Amebiasis and Giardiasis.
A: Disease transmission refers to the spread of disease from one person or organism to another. It can…
Q: make a venn diagram about the characteristics of cats and dogs.
A: Introduction : A Venn diagram is a diagrammatic depiction of ALL the potential connections between…
Q: Cancer develops from the accumulation of multiple mutations within a single cell. Name the 3 sources…
A: Errors in DNA replication during cell division, exposure to mutagens, or viral infection can all…
Q: Based on the results of your chi-square test, briefly explain whether your observed numbers and your…
A: The Chi-Square statistic is used for testing relationships between categorical variables. If it is…
Q: How is Bicarbonate move back and forth from the plasma and red blood cells? Why is this important?…
A: Enzyme carbonic anhydrase transforms carbon dioxide into carbonic acid inside red blood cells…
Q: Name three enzymes that are likely the source of bicarbonate ion that is involved with the formation…
A:
Q: 2. What happens to the follicle during the first 14 days that you plotted? 3. What happens in the…
A: Introduction : The menstrual cycle is the term used to describe the monthly cycle of these changes…
Q: Which policy simplified and streamlined the process for FDA approval of generic drugs in exchange…
A: In accordance with the "Drug Price Competition and Patent Term Restoration Act of 1984," also…
Q: Explain how the conduction pathway in the heart co-ordinates the different stages of the cardiac…
A: The atrial muscles contract as the SA node initiates the process. Doctors sometimes refer to it as…
Q: Isotonic solutions have definitions that it has the same osmotic pressure as 0.92% w/v aqueous…
A: ORT: It is a rehydration therapy given to patients with symptoms of dehydration. A hypotonic saline…
Q: 7) The figures below depict nine interacting microbes. The center cell (black circle) is the…
A: Altruism is the phenomenon in which one organism's behavior benefits another while suffering itself.…
Q: In snapdragons, the inheritance of flower color and size of leaves are examples of Incomplete…
A: Homozygous and heterozygous are the terms that are used to describe allele pairs. *Individuals which…
Q: 1. What sex chromosome combination does a female have? 2. What sex chromosome combination does a…
A: Disclaimer: - According to BNED guidelines, only the first 3 fill in the blanks questions can be…
Elobrate the research methodology of sampling design for andragogy
Step by step
Solved in 2 steps
- Give an example of an analysis of a particular sample and include the steps in quantitative methods of analysis.Review available slatter system and deep litter system on the modern technology that are used in broiler farmsDesign appropriate approaches for measuring the population size of different types of samples
- Differentiate transect and quadrat sampling. What are strengths and weaknesses of using such methods in doing terrestrial community ecologyDescribe techniques (measures/ tools/ instruments) one would use to collect data for a quantitative research article?Distinguish between qualitative and quantitative sampling, highlighting three key distinctions
- When writing a scientific report there is no need to report and if percentages are being reported. True or false?Compare the advantages and disadvantages of public and private solid wastw collection system.Explain the following sampling techniques that are used in selecting sample elements out of a population in research. Snowball sampling Stratified sampling
- compare and contrast Qualitative from Quantitative Approach using a venn diagramThe selection of sites for sampling must be A. selected and sampled from largest area to smallest. B. carefully selecting for specific features by the researcher. C. methodical and must all be within close proximity to each other. D. random.Arrange the step in the dropdown menu in the image.
