G-LO37 Identify the consequences of mutations in different regions of a gene. The image below represents two strands of DNA: the top one corresponds to a healthy individual, and the bottom one of a sibling potentially affected with a disease due to genetic mutations Mutation 1 +. с AUA J AUG Met GUU GUC GUA GUG Val ACA ACG GCUT GCC GCA GCG It will result in mRNA produced Mutation 2 It will result in no mRNA produced 500 AGG The protein produced will be normal 500 GGG Ala The Select all that applies about Mutation 1 (position -6): AAGLys GAU ASP GAAT GAGJ Glu Mutation 4 The protein produced will have a different amino acid AGG Arg GGU GGC GGA GGG Gly 1235 ATT 1235 TTT 0102030 U Mutation 3 The mRNA and protein will both be normal because the mutation occurs outside of the consensus region of the promoter The mutation occurs in the promoter region, and this means that the mRNA cannot be produced G 1535 Affected

G-LO37 Identify the consequences of mutations in different regions of a gene. The image below represents two strands of DNA: the top one corresponds to a healthy individual, and the bottom one of a sibling potentially affected with a disease due to genetic mutations Mutation 1 +. с AUA J AUG Met GUU GUC GUA GUG Val ACA ACG GCUT GCC GCA GCG It will result in mRNA produced Mutation 2 It will result in no mRNA produced 500 AGG The protein produced will be normal 500 GGG Ala The Select all that applies about Mutation 1 (position -6): AAGLys GAU ASP GAAT GAGJ Glu Mutation 4 The protein produced will have a different amino acid AGG Arg GGU GGC GGA GGG Gly 1235 ATT 1235 TTT 0102030 U Mutation 3 The mRNA and protein will both be normal because the mutation occurs outside of the consensus region of the promoter The mutation occurs in the promoter region, and this means that the mRNA cannot be produced G 1535 Affected

Name: G-LO37 Identify the consequences of mutations in different regions of
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: G-LO37 Identify the consequences of mutations in different regions of a gene.The image below represents two strands of DNA: the top one corresponds to a healthy individual, and thebottom one of a sibling potentially affected with a disease due to ge

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
In a study of several families for differences in the sequence of a particular gene suspected to cause a disease. Resulting in the discovery of different mutations in the genes of some families. For each of the mutations, specify if it could change the size or the quantity of mRNA and/or protein product? What kind of change would you predict? Explain each answer briefly. d. AAG378UAG e. promoter mutation. f. one base-pair insertion into codon #765 g. deletion of whole codon #765 h. G-to-A substitution in the 5' UTR i. insertion of 100 base pairs into the fourth intron (this insertion does not alter splicing).
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
With this gene provided: MuPKS c.1949 C>T (p.R644W) Please provide the following; 1. Name of the gene 2. Location of the nucleotide change 3. Nucleotides that are changed 4. Type of mutation 5. Amino acid change 6. Location of the amino acid change
As described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base sequence of a coding region changes by any number of bases other than three base pairs, or multiples of 3, a frameshift mutation occurs. Depending on the location of the sequence change, such mutations can have serious effects. The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUC-AUGUUU-3′ First, determine the amino acid sequence of the polypeptide. Then determine the types of mutation that have occurred in the following altered mRNA segments. What effect do these mutations have on the polypeptide products? a. 5′-AUGUCUCCUACUUGCUGACGAGGGAAGGAGGUGGCUUAUCA-UGUUU-3′ b. 5′-AUGUCUCCUACUGCUGACGAGGGAGGAGGUGGCUUAUCAU-GUUU-3′ c. 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCCCUUAUC-AUGUUU-3′ d. 5′-AUGUCUCCUACUGCUGACGGAAGGAGGUGGCUUAUCAU-GUUU-3′
Geneticists are studying a malfunctioning protein that causes impaired endothelial cell migration and angiogenesis. They have noticed that the amino acid sequence of the protein is truncated compared to normal controls. The mutated mRNA strand is isolated, and analysis shows a nonsense mutation located near the 3' end of the coding region. The 3' terminal coding sequence of the abnormal mRNA strand is shown below. 5`- AUG-ACC-ACU-CCA-CUG-UUG-UUC-CAA-GGG-GAG-AGC-UAG-GUC-CGG-GGC-GGA-AAA-UUU-UAA-3` Write down the tRNA anticodon responsible for adding the last amino acid?
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
The following is a list of mutations that have beendiscovered in a gene that has more than 60 exons andencodes a very large protein of 2532 amino acids.Indicate whether or not each mutation could cause adetectable change in the size or the amount of mRNAand/or a detectable change in the size or the amountof the protein product. (Detectable changes in size oramount must be greater than 1% of normal values.)What kind of change would you predict?a. Lys576Val (changes amino acid 576 from lysineinto valine)b. Lys576Argc. AAG576AAA (changes codon 576 from AAG toAAA)d. AAG576UAGe. Met1Arg (at least two possible scenarios exist forthis mutation)f. promoter mutationg. one base pair insertion into codon 1841h. deletion of codon 779i. IVS18DS, G–A, + 1 (this mutation changes thefirst nucleotide in the eighteenth intron of the gene,causing exon 18 to be spliced to exon 20, thusskipping exon 19)j. deletion of the poly-A addition sitek. G-to-A substitution in the 5′ UTRl. insertion of 1000 base…
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
Name three different types of loss of function mutations and in each case explain how the mutation exerts a loss of function effect on a gene
Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is: 5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA 3’ What type of mutation has occurred? (max 1 sentence) Does this result in an amino acid change? If yes, identify the change that has occurred. (max 1 sentence) Based on your answer to Part 2, will this mutation impact the structure of the protein? Justify your answer. (1-2 sentences) Responding in point form is allowed!