Q: How many total sister chromatids would be present a human cell for the following? 1) Mitosis,…
A: Sister chromatids are identical copies of chromatids that are formed during replication. They are…
Q: work rate at VT2 may better reflect buffering capacity
A: work rate at vt2 may better reflect buffering capacity. Ice hockey performance involves intermittent…
Q: Contraction of sarcomeres is dependent upon the motor protein attached to and moving along
A: The germ layer, mesoderm, is the source of soft tissue called muscles. Connective tissue is…
Q: Farming is often done on the large-scale to allow for high-volume production. For example, tomatoes…
A: Tomato plants are a type of flowering plant in the nightshade family. They are native to South…
Q: Genetics and environmental factors that cause cancer Genetic predisposition to cancer does not play…
A: When cells get old or damaged, they die and are replaced by new ones. When cancer develops, however,…
Q: Neurons Dendrites Signalling Direction Axon (Diameter 1-20m Length 1mm-20m Cell Body Terminal…
A: Electrical signals regulate the contraction of muscle, secretion of hormones, sensation of the…
Q: O Do concussions cause memory loss?
A: A brain injury is caused by an external force, but it also includes any subsequent repercussions,…
Q: Calculate the PO2 of air that is made up of 21% oxygen. We are at sea level where atmospheric…
A: The pressure of a single gas component in a mixture of gases is referred to as partial pressure. It…
Q: In mammals , the evolution/ development of the organs of the digestive system is closely related to…
A: All of these specialisations are connected to digestive system development. Because the stomach was…
Q: QUESTION 8 Identify the correct statement. O a. DNA is partially replicated but completely…
A: Replication is the process of making a copy of DNA. DNA replication occurs in S phase of interphase.…
Q: Oxidation of ingested CHO during exercise depends on each of the following variables except... Group…
A: Carbohydrates are one of the essential nutrients present in the food. It is made up of carbon,…
Q: A patient who is homozygous for familial hypercholesterolemia (FH) will: OA) have only one defective…
A: Introduction: A chromosomal 19 abnormality causes familial hypercholesterolemia. Familial…
Q: What is the MAPK signaling pathway? What are the important enzymes and their function within the…
A: •MAPK signaling pathways have also been identified in higher organisms. In mammals, three major…
Q: In general, larger plants have larger organs. So, one option for increased yields is to breed and…
A: Generally, larger plants have larger organs than smaller plants. This is because the size of a…
Q: oth microarray and RNA-sequencing can study the transcriptomes. Compare microarray and RNA…
A: Microarray is based on hybridization while RNA sequencing includes cloning and sequencing.…
Q: In terms of enzymes, a decrease in Km best reflects an enzyme that has Select one: O b. OC. a lower…
A: Enzymes are the proteinous substances required for accelerating the rate of any chemical reaction.…
Q: Fat oxidation is mainly influenced by ______ availability and the rate of _______ utilization. Group…
A: Facts are one of the essential nutrients which is required as a energy giving food along with…
Q: Potential negative effects of rapid weight loss through fasting or crash dieting include... Group of…
A: Introduction:- Biomolecules are required by our body for cellular growth and maintenance. These are…
Q: describe 10 different chemicals signals which can have a profound effect on eukaryotic cells
A: Eukaryotes are those organisms that contain specialized enveloped sub-cellular structures…
Q: Which would be the best advice for an endurance athlete who wants to lose weight and continue…
A: Solution:- Advise for the weight loss and training :- 1) Eat low calories foods. 2)Eat low fat…
Q: How does exercising at sea level affect the oxygen-hemoglobin dissociation curve.
A: An important part of the transfer of oxygen is handled by hemoglobin. How much oxygen is linked to…
Q: Keratin is a type of found in the cytosol, which means its hydrophobic amino acids are Select one:…
A: Keratin is a type of protein that is also known as scleroprotein. This protein is present in hairs.…
Q: The overall goal of chemiosmosis is to make Select one: O a. NADH, Kreb's Cycle O b. NADPH, Calvin…
A: Introduction : The electron transport system/chain, or ETS/C, is the metabolic mechanism of…
Q: Telomeres serve as caps protecting the ends of linear chromosomes. Which of the following is FALSE…
A: Telomeres are DNA sequences found at the end of chromosomes that protect the chromosome from damage…
Q: Describe the benefits of adding sodium to a sports drink.
A: Sodium and other electrolytes are lost during exercise or workout in the form of sweat which results…
Q: When the training goal is power development, exercise methods should address which of the following?…
A: Introduction Strength Training shows the ability to overcome resistance, while power training shows…
Q: Glomerular filtration rate is controlled by: 1. autoregulation mechanisms, including…
A: The process of generating urine begins with glomerular filtration. The kidneys utilize this…
Q: pyramid. Explain this phenomenon. (c) An ecologist is doing an in-depth study of a tundra ecosystem.…
A: Given, Producer biomass per square meter is. = 3.5 kg/m2.
Q: YOU ARE WORKING WITH A NEW DRUG TO TREAT BREAST TUMORS. PRESENT AN OUTLINE OF THE STEPS YOU WOULD…
A: Tumours are abnormal growths of tissue that can occur anywhere in the body. They can be either…
Q: Consider the sequence below for amplification: GGCGTAGGCTGATCGTGGGCTCTAGGGGGCTGCTGCTGCTATTATGCTGGC…
A: The polymerase chain reaction (PCR) is a molecular biology technique to amplify a DNA segment of…
Q: What are the daily protein recommendations for strength and endurance athletes? Describe a strategy…
A: Protein is the primary structural component of muscles, and muscle protein synthesis is a naturally…
Q: Alpha diversity describes the number of species occurring locally.
A: The term "biodiversity" refers to the variety of life forms that exist on the planet, whether they…
Q: Which of the following plates (dilution factor) would you count/use to determine the original…
A: The colony-forming unit is the estimated number of bacterial cells in the culture that are viable…
Q: The sunlight that floods Earth is the ultimate source of energy that keeps the planet functioning.
A: The Sun is the ultimate energy source for Earth because, like all stars, it is essentially a massive…
Q: A more recent threat to tree survival is a fungus in the genus Phytophthora which can kill…
A: A fungus belonging to the genus Phytophthora can kill full-grown trees after it has infected it. It…
Q: Explain how plants are pollinated and give two examples of pollinators.
A: A plant is made up of various components. Distinct components provide various purposes. The shoot…
Q: How does intensity and duration impact the type and amount of CHO consumed during an activity?
A: Carbohydrates, Proteins and Fats are the three important molecules which makeup the body system.…
Q: If an EMT-inhibiting drug was able to cross the placental barrier, what do you expect would happen…
A: One of the biggest causes of death among people is cancer. Although cancer science has made…
Q: Our understanding of the molecular biology of cancer formation has been greatly enhanced by studying…
A: The genes which cause cancer when mutated are called as oncogenes. The genes which are mutated to…
Q: Both detritivores and predators are heterotrophs. True False
A: Introduction A heterotroph is an organism that eats other plants or animals for their energy and…
Q: What is Genomics?
A: Genomics is defined as the study of organism's complete set of genetic information. It is a branch…
Q: Which of the following DOES NOT alter a [population’s genetic composition? a. random mating b.…
A: Introduction Genetics is the study of genetic characteristics of an organism in a population.…
Q: he Nutrient Photolysis Hypothesis states that: melanin is important in the synthesis of the…
A: ANSWER) The Nutrient Photolysis Hypothesis states that the skin with higher concentration so melanin…
Q: List two ways in which determining the titer of a bacterial sample is similar to that of a viral…
A: On a molecular level, the primary distinction between bacteria and viruses is that the former are…
Q: If pulse pressure is calculated to equal 40 mm Hg and diastolic pressure is 70 mm Hg, then systolic…
A: The human heart acts like a pump which is used to pump the blood due to the blood experiences a…
Q: Explain why the following statement is true: RNA polymerase copies template DNA in the 3’ to 5’…
A: RNA polymerase, that creates a complementary strand of RNA using a single-stranded DNA template, is…
Q: During sarcomere contraction, Select one: Oa. Calcium, troponin Ob. Calcium, microfilaments O c.…
A: The answer is option A- calcium, troponin
Q: Discuss how in situ and ex situ approaches can be used to bioremediate soil and groundwater.
A: Bioremediation is a procedure that employs biological systems such as microbes and plants to reduce…
Q: what are the effects of caffeine on the nervous system? Why does it have these effects?
A: Please follow step 2 for detailed explanation.
Q: ABOC 10) For every ammonium secreted into the urine what enters the peritubular capillaries? A)…
A: A luminal sodium/Ammonium exchanger transports the Ammonium ion into the renal lumen in exchange for…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Genetics of man question:Provide the expression pattern of the gene ,GATA binding 3 (GATA3).Genetics of man question:Describe the molecular genetics analysis for the GATA binding protein gene and consider the possibility of lethality and functional redundancy and experimental strategies to address possibilities.>mutant1…
- how to identify mutant genes molecularly bytransformationTopic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question Describe the molecular genetics process using proper scientific terminology. Describe the steps that are involved. How is it performed?Determine the responsiveness of the wild-type protein to maltose, the way by which mutation affects the function of the protein, and the most probable nature of the mutation in the gene at the molecular level.
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. 3: Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics?Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. 1) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?Protein expression: Given that we control the composition of the medium in which we grow our bacteria, are there any additional advantages of recombinant expression of proteins compared to using chemical synthesis?
- State whether the gene is up- or down-regulated and briefly explain the reason behind. DNA lacks methylated cytosine residues.23. gene amplification results in larger amounts of gene products true or falseHELP PLEASE !! In moelcular genetics, initiation is often accomplished using proteins that prevent elongation. Name and describe 3 processes where this happens, they can be in different species. Make sure to name or describe the proteins and substrates involved and how the elongation inhibition is overcome.
