H C-N NH3 но CH, H A: Name? Phosphate -C-CH2-CH2-CH-COO B: Enzyme? H,N C: Name?
Q: Draw on a piece of paper, take a picture and upload the tripeptide: Gly-Phe-Ala How many…
A: Two to fifty amino acids combine to form a peptide. If more than 50 amino acids are present in a…
Q: formed between two different polar molecules. Tollowing describes O Covalent O jonic Hydrogen O…
A: A polar molecule is a chemical species in which the distribution of electrons between the covalently…
Q: Which of these will have the highest charge at pH 7.0? Leu-val-asp Asp-met-glu Lys-trp-tyr…
A: Peptides are small chains of amino acids joined together through peptide bonds. Charge of an amino…
Q: Glucose is to a polysaccharide as... * O shoes are to feet O fruits are to vegetables O numbers are…
A: Most biomolecules are polymers made from different monomers. The common biomolecules include…
Q: 1. Indicate whether each of the following molecules is an alpha amino acid or not and explain why. a…
A: The -amino acids get their name from the fact that the alpha-carbon atom in the molecule has an…
Q: H,Ñ-CH-C–NH-CH-C-NH-CH-C-0 CH, CH-CH; СНОН CH, ČH; ČH;
A: The given peptide is composed of three amino acids; it can also be called tripeptide. The sequence…
Q: Oligosaccharide (disaccharides), type of carbohydrates, which contains O 1 sugar molecules O 2-10…
A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…
Q: 9. Catalase activity 10. Glycolysis
A: Catalase is an enzyme that breaks down hydrogen peroxide into water and oxygen. Factors affecting…
Q: How many chiral centers are present? CH,OH C=0 HO -H- Но- -H- H- -HO-
A:
Q: Suggest a name for the enzyme that catalyzes the following reaction.
A: The given reaction involves the reaction of phenylalanine (Phe) amino acid with the α-ketoglutarate…
Q: What two amino acid side chains are necessary for a disulfide bridge to form? A. -SH and -SH B. -S…
A: Disulfide bridges are also known as disulfide bonds between two different amino acids. Disulfide…
Q: sub= 18 help
A: The reaction given in the question involves the conversion of dihydroxyacetone phosphate to…
Q: A polypeptide with a pH of 2.0 has a total net charge of 0. Gly-Pro-Glu-Asp-Leu-His-Ile-Gln-Asn-Phe…
A: This peptide is composed of glycine, proline, glutamic acid, aspartic acid, leucine, histidine,…
Q: nonpolar Basic, Group hydrophobic neutral а. CH2 „CH CHS CH3 b. с. CH2 CH2 CH2 CH2 NHs* d. CH2 OH
A: A hydrophilic molecule or functional group is an entity that is attracted to water molecules and…
Q: a: 4. Add additional hydrogen atoms and bonds to sho A. Saturated fatty acid -c-c-c-c-- H. I I…
A: Fats are also known as triglycerides that consist of three fatty acids bonded to glycerol. Fats can…
Q: Cofactor Nucleoside Homocysteine Sphingolipid 6. 7. 8. 9. НО НО ОН P-O но о 0=р НО. Но НО 10. НО. но…
A: A nucleotide is the basic building block of nucleic acids (RNA and DNA). Phospholipids constitute…
Q: Which of the following is NOT a polymer? O a. DNA O b. Proteins O c. Cellulose O d. Glycogen O e.…
A: Polymer - These are the substances which contains large molecules composed of many repeating…
Q: The nucelotides in a single strand of DNA or RNA are connected bya type of covalent bond called (n)_…
A: DNA is made up of many Nucleotides. Each nucleotide is made up a sugar molecule (either ribose in…
Q: Which of the following does NOT contain 1,4 glycosidic linkage? వార్ CH,OH CH,OH CH;OH CHOH о он HO…
A: Glycosidic linkage refers to C-O-C linkage between two carbon atoms of different monosaccharide…
Q: Two cysteine amino acids can react together to form a dibasic bridge between two different parts of…
A: Proteins are formed from different amino acids linked together by peptide bonds. There are 20…
Q: What is the other reactant required in this reaction? (Box 2) * H H H-C-0-H -Ra но- 2 H-C-0-H но-…
A: The lipids are hydrophobic molecules and one of the most important biomolecules that is present…
Q: Identify the hydrophobic and hydrophilic regions in thefollowing molecule. How does it orient itself…
A: Lipids are known to play a vital role in living organisms largely due to the presence of hydrophobic…
Q: How many molecules of water are used to breakdown this polypeptide, using hydrolysis reactions, into…
A: Proteins are essentially large biomolecules in nature. They comprise one or several chains of amino…
Q: The symbol for the fatty acid below is ________________: ________________, n-____________________.…
A: Lipids are biomolecules made up of carbon, hydrogen, and oxygen just like carbohydrates but in…
Q: Figure 3 shows two polysaccharides, A and B. Name the polysaccharides A and B. Briefly distinguish…
A: Polysaccharides are ubiquitous in nature. Polysaccharides are polymers with hundreds or thousands…
Q: H What is this molecule? N-C-C OH R Name this molecule Explain
A: Protein is made up of a monomeric unit called amino acid and there are 20 amino acids that code for…
Q: Which of the following is achiral amino acid cooe co0e H,N-C-H CH3 H,N-C-H CH, OH CH3 HO HN- NH2 NH2…
A: A tetrahedral carbon containing four different group is called as the chiral carbon. Chiral carbon…
Q: 1. The molecule below is a pentose. C/OH H- HO- НО -H НО C/OH
A: As you have asked multiple questions we are supposed to answer only first question for you. If you…
Q: subunits. Chitin is a polymer of a. N acetyl D glucose b. D glucose C. D methyl glucose d. D…
A: Carbohydrates are the most important biomolecules that provide us the energy and they are made up of…
Q: The R group of aspartic acid is –CH2COOH. What will the structure of the amino acid be at a very…
A: Amino acids are biomolecules that contain amino and carboxylic acid groups. These groups are present…
Q: O= OH Gln Glu HO ÓH NH2 NH2 ÑH2 B: Enzyme? C: Name? A: Name?
A: Amino acids are organic compounds that act as the monomer units for proteins. The alpha-amino acids…
Q: . chemical can used to cross link bio molecules -formamide -N-avetyl cysteine -hydrogen…
A: The chemical process of linking two molecules is known as crosslinking.
Q: A monosaccharide is formed from a polysaccharide inwhat kind of reaction?a. oxidation–reduction…
A: Nutrition is interrelated to metabolism. Nutrition is key to metabolism. Metabolism depends on…
Q: Which of the following is a glycerophospholipid? H,C-O HC-O H,C-O а. b. он HO NH2 C. d.
A: Glycerol is a colorless, odorless, viscous polyol. Glycerol is used in the treatment of wounds and…
Q: Consider the following molecule. a. Name it.b. Use the three-letter symbols for the amino acids…
A: Amino acids are organic compounds that contain the amino (–NH2) and carboxylic acid (–COOH)…
Q: nd me; How are monomers joined together into poly ners ! How are poly mers broken apart into mon…
A: How are monomers joined together into polymer? A process called - dehydration synthesis ( where 2…
Q: HOCH,--C--c- H. OH OH H OH Glucose ÇI,-0-C-(CH) CH, CH-o-C-(CH,),. C-(CH)CH, A triglyceride CH, O…
A: Here in the given structures, One is monosaccharide, one is triglyceride, one is a peptide and one…
Q: Peptidoglycan, part of the bacterial cell wall, uses a polysaccharide chain with strong beta…
A: Polysaccharides are carbs made up of a lot of monosaccharides that are joined together by O…
Q: Part A Drag each amino acid into the box corresponding to its classification. Reset Help NH3 CH2 CH2…
A: 1st amino acid is lysine 2nd is asparagine 3rd is glutamate 4th is leucine
Q: OH HHHHHH -0-č-C-C-C-C-C- H--- OH H HHHHHHHHH Co-C-c-c-c-C-c-c-c-c-c-c-c-H B A онннн ННННН НН…
A: Triacylglycerol is a lipid molecule that consists of glycerol molecules attached to the three fatty…
Q: Which methyl groups are from SAM? CH3 CH30 CH3 H3C H3C H3C' COCH3
A: Methylation is the process by which methyl groups (-CH3) are added to biomolecules by replacing a…
Q: Which molecule is a nucleotide? ATP Deoxyribose The amino acid glycine
A: Pls refer below for the solution :
Q: Which of the circled monosaccharides is an unusual deoxy sugar called L-fucose? I II…
A: Fucose is an unusual monosaccharide with six carbons. And fucose is a deoxy sugar, which lacks…
Q: Which disaccharide does NOT have an anomeric carbon available for oxidation? O A. Glucose (beta1 1…
A: The question does not have the correct option. We are answering the question based on the general…
Q: I-D-E-L-Y-S-Q-V-C-S-H-L-D-T-V-R Circle the hydrophobic residues in the amino acid sequence above…
A: Amino acids are classified into 20 different types based on their physicochemical properties. They…
Q: Which of the following has the sugar found in RNA? A. D. Но- OH HN. ÓH но ОН ОН В. E. NH2 H. OH…
A: RNA have the following nitrogen bases:- nitrogen bases in the RNA are - 1) Uracil , 2) Adenine , 3)…
Q: 6. Glycosylation reaction 7. Lipid synthesis 8. Degradation reactions 9 Catalase activity
A: Multiple subparts asked. I can answer initial 3 subparts , as allowed by guidelines.
Q: Simple sugars Enzyme 1. Carbohydrate Steroids 2. Lipid Guanine 3. Protein 4. Nucleic Acid…
A: Carbohydrates are the sugar molecules. Along with fats and proteins. They are one of the 3 main…
Q: Which set of 4 branches, when attached to a carbon, would create a chiral carbon? -H -OH -F -H -CI…
A: Chirality is an important geometric property of a molecule by which the mirror images of the…
Provide A, B and C in the above reaction.
Step by step
Solved in 3 steps with 1 images
- Identify the sequence'of the peptide below. C-N-CH-COOH C-N-CH- H H CH- H,N*-CH-Ċ-N-CH-Ċ-N-CH-Ö-N-CH-Ċ- H CH, CH2 ČOOH H CH, H CH, H CH, CH, CH, CH2 *NH, H CH, он CH, SH S CH, O CAEKGSM O MSGKEAC O CAKEGMS O KEACMSGCut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are present after the protein is treated with Trypsin? Val-lle-Arg-Lys-Leu-Arg-Gly-Ala-Lys-lle 6. 10Draw the peptide at a pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr
- NAZO NHZ Ala-Cys-Glu -Tyr - Trp - Lys - Arg - His -Pro-G ly Glu pka 4.15 SH Tyr 10.10 Draw Charges Lys 10.67 Olt A3 12.10 +NH₂ Ntrm 2) Calculate net charge 3) write out I letter code 300 Ctim 3 juli of peptich (above) Ⓒ pH; 1,7,12Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are present after the protein is treated with Trypsin? Ala-Leu-Arg-Gly-Met-Val-Arg-Lys-Ala O 2 6. 8.My PDB code: 3GRS residue point: 66 (LYS) mutation: VAL
- 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 --+---- 70 3′-GGCTATATTACTCAGCAGCAGACCCGGAAGTACATAAGTACCCTTCTCTCACATTACAAACGGATTCCGG -5' 1 11 -#- -+-- +-- a) Draw a green box around the promoter. b) Label the template strand of the DNA on the sequence above. --+-- -+ c) Write the sequence of the pre-mRNA. d) This gene has a small intron and the intron splice sites has the composition 5'-GUG-3' (for the 5' splice site) and 5'-UUG-3' (for the 3' splice site), meaning that these sequences and everything between them will be removed from the mature mRNA. -Draw a box around the intron on the DNA sequence above. e) Write the sequence of the peptide that is translated from the mature mRNA and label the directionality of the peptide. f) Imagine that, in the process of DNA replication, the 39th base in the gene (with the *) was changed from A/T to C/G. What would be the effect of this mutation on the produced peptide?T/F: This reaction probably produces NADH in a cell O True CH2OH H-OH O False HO-H Н- H-OH H-OH CH₂OH НО- Н H CH2OH Fo What principle was common to all reactions that produced NADH in the Citric Acid Cycle? -H -ОН -OH CH₂OHMet – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile – Tyr – Lys – Asp mRNA sequence (5’-3’)AUG – AAC – UGU – UUU – GAA – AUG – CUU – CGU – AUU – GAU – GAA – GGU – CUU – CGU – CUU – AAA – AUU – UAU – AAA – GAU - Write the dsDNA that encodes for this peptide