Q: Which of the following systems DOES NOT share interrelated functions with the Endocrine System?…
A: Endocrine system comprises of different organs and glands. Endocrine glands secrete hormones that…
Q: 333
A: The procedure through which a parent cell splits into two daughter cells is known as cell division.…
Q: what are the chemical classes of hormones and give an example of each
A: Hormones are the chemical substances secreted by highly specialized cells present in our body. These…
Q: For urinary portal of exit, do all parasites live within the kidney, ureter or bladder? Explain.
A: The urinary portal of exit is the area that connects the organs involved in urine production and…
Q: How many different reading frames are possible in a stretch of double-stranded DNA?
A: Introduction -open reading frame = • In molecular genetics, an open reading frame (ORF) is the part…
Q: Which of the following statements is TRUE about the American experience with psychoactive drugs? A.…
A: Psychoactive drugs are chemicals/substances that when consumed interfere with the normal functions…
Q: If the body does not respond to insulin (insulin resistance), it would lead to: a.…
A: ANSWER: The correct option is: b. hyperglycemia.
Q: For each G protein below, draw an arrow to its downstream effector(s), second messenger(s), and…
A: G proteins, sometimes referred to as guanine nucleotide-binding proteins, are a family of proteins…
Q: if the DNA sequence if: TTACGTA, the complementary RNA sequence will be following
A: Transcription is the process of copying a segment of DNA into RNA. The segments of DNA transcribed…
Q: Which of the plants shown in the figure will not grow towards the light? Select two correct answers
A: Plants produce chemicals called plant growth hormones or plant growth regulators. These hormones…
Q: Translate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids:
A: DNA is a molecule that carries genetic information. It contains instructions used in the growth,…
Q: ow can i use a resourse for this?
A: 1. Stomach: The stomach has specialized circular and longitudinal muscles that aid in the process of…
Q: I am a nurse and like all nurses I got really busy last week and read the orders from the MD…
A: A 1% NaCl infusion, also known as normal saline, is a common medical treatment used to hydrate and…
Q: Create a Study Tool of Eukaryotic cell organelle. Be sure to include both structure (draw or…
A: A nucleus, mitochondria, and an endoplasmic reticulum are membrane-bound organelles found in…
Q: What is the growing cycle of a sweet potato and state its requirements for water, nutrients, and…
A: The family pf morning glory includes the tropical plant known as the sweet potato. You can observe…
Q: 1. Give the normal differential count of the different blood cells seen. 2. Briefly define the…
A: A differential blood count reveals abnormal white blood cell populations and provides the…
Q: Can you match these prefixes, suffixes, and word roots with their definitions? micro- -phyll hyper-…
A: There are different words in biology,which are used to describe particular process,or…
Q: 3. As discussed in class, single lipid layers are a great way to package materials (like drugs or…
A: Introduction:- Lipids are a type of organic compounds that are mostly insoluble in water but they…
Q: Scenario: plant species has flowers that can be red, pink, or white. Flower color is controlled by…
A: According to the Hardy-Weinberg equilibrium, in a population genetics states that, if other…
Q: 1 When your body is breaking down organic biomolecular polymers in food into their component…
A: A biochemical reaction is a chemical reaction that takes place in living organisms. Chemical…
Q: sis(1) - Saved ansitions Animations add notes C $ 4 101 BIUS ab AY - Aa- - A R F Slide Show Font 16…
A: From the given image the answers to the given questions are as follows:- 1. % of Glucose outside the…
Q: Which of the following statements is true regarding the lys2-128d reporter? Select all that apply.…
A: INTRODUCTION Lys2-128d is a reporter allele of the Spt- gene in Saccharomyces cerevisiae (yeast)…
Q: 5. Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of…
A: Introduction The genome consists of DNA/RNA, consisting of either deoxyribonucleotide (In DNA) or…
Q: what is the human genome
A: Introduction : The gene is generally regarded as the fundamental component of heredity. Genes are…
Q: What is the importance of terrestrial ecosystem?
A: Ecosystem means living organisms along with their physical environment with which they interact.…
Q: demonstrate an understanding of and assess factors that affect performance during human movement.…
A: The solid bones in human body, the joint tissues responsible for connecting the bones are the…
Q: How many genes are there in human sperm cells? A. 23 B.46 C.5,000-10,000 D.About 23000 E.About…
A: INTRODUCTION A human sperm cell is a reproductive cell produced in the testes of males which is…
Q: How is knowledge in cell division applied in research?
A: Introduction: The biological process of cell division is when a cell divides to produce daughter…
Q: Describe the mechanism by which histone modifications are established after DNA replication and cell…
A: Post-translational modifications - Many proteins undergo chemical modifications at. certain amino…
Q: 8-The definitive host of Toxoplasma gondii (Toxoplasmosis), is: A-Cat B-Pig C-Birds…
A: Introduction: Most warm-blooded animal species, including humans, are infected by the protozoan…
Q: How did you get that?
A: The probability is zero.
Q: Ligaments have what fiber type and why? Connective Tissue: Loose and Dense Tissue Fibers (Short…
A: Note:- Please always mention the needed parts in case of multiple questions. Thank you! Every…
Q: Compare and contrast the structure and function of ligaments and tendons
A: Skeletal system in the body is made up of bones, ligaments, tendons and cartilages. Bones are made…
Q: discussion on obejective lenses: screening, low and high power objectives in whitefish blastula
A: A microscope is a device that generates magnified pictures of small objects, allowing the viewer to…
Q: Golden Line: Rationale: (Tell me why the authors put this diagram here. What do you think is its…
A: The fluid mosaic model is a widely accepted theory that describes the structure and function of the…
Q: 1) In the plant Salvia, two genes determine the inheritance of flower colour. For one gene, P is the…
A: Epistasis is defined as the interaction between genes that have no alleles, especially the…
Q: Which of the following statements related to intercellular junctions is false? O Cadherins are…
A: Cell junctions, also known as intercellular bridges or junctional complexes, are a group of cellular…
Q: DNA: Using the two deoxynucleotides you chose, draw the two monomers bound together into a compound,…
A: In deoxynicleotides, carbon number four of sugar moeity has a hydrogen group attached to it while in…
Q: A region where the temperature changes sharply on a short distance is called: 00 A temperature…
A: A temperature front is a region where two different air masses meet at the surface of the Earth. The…
Q: Calculate the amount of GFP in grams produced in the 25-L fermentation used to generate cells for…
A: The green fluorescent protein is an autofluorescent recombinant protein extracted from the jellyfish…
Q: How do these 2 B lymphocytes differ and what could explain why they are different?
A: The B Cells or Lymphocytes are important immune cells that help the body in fighting infections…
Q: What is a gene? How many oxons are in the basic structure of a gene
A: A gene is in charge of determining an organism's physical characteristics and regulating its…
Q: For each of the following sentences, fill in the blanks with the best word or phrase selected from…
A: Dynein and kinesin are two of the proteins bound to microtubules. Tubulin-based building blocks make…
Q: 1) In some species of pea plant, pea colour is determined by one pair of alleles and pea shape by…
A: It is said here that in some pea plant species, pea color is controlled by one pair of alleles while…
Q: There is a situation in which a gene has five exons. Please draw four possible mature products of…
A: Alternative splicing is a biological process that involves the joining of exons from the same gene…
Q: Overexpression or underexpression of cytokines or cytokine receptors have been implicated in several…
A: Cytokines are a type of protein molecule produced by cells in the body, including immune cells, that…
Q: Part 3: How would you design an experiment to test the following observations? For the following…
A: Experiments are done to prove something, for that we need the group of individuals or other…
Q: Study the following questions: 1. Define the terms: transcription, promoter, enhancer, terminator.…
A: Transcription is the process of converting genetic information from a DNA molecule into an RNA…
Q: Which of the following statements about the cell cycle is TRUE? a. The protein APC blocks cells…
A: INTRODUCTION The cell cycle is the sequence of events that a cell goes through from its creation to…
Q: sex-specific behavior can be best described as: a) Their role is in activating neural circuits that…
A: Gonads are male and female reproductive organs. For example, the main male reproductive organ that…
Importance of the biosafety level with respect to the disease prevention and management.
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- The process of microbiological risks assessment for fish & sea foods.A pathogen that has an extremely low LD50 would be Group of answer choices very contagious. very difficult to treat. very deadly. very oncogenic. very communicable.Foodborne pathogens often require the presence of a large number of microbes before an active infection results. These microbes would have a high Group of answer choices virulence. incubation period. mortality. median lethal dose (LD50). median infectious dose (ID50).
- True or false? Passive surveillance refers to provider-initiated surveillance where healthcare providers send reports of a disease to the health department on the basis of a known set of rules and regulations.an example of infectious disease and outline and symptom, the infectious agent, risk factors treatment and prevention.evidence-based response is highly appreciated
- A drug failed to work. Even if resistance is not an issue, the antimicrobials are found to only have a discrete range of bacteria that they can exert their effects on. Why is this the found case? Question options: Microbial components vary over different species and strains. If the organism naturally doesn't express the target component, the drug won't be able to exert an effect on it. Antimicrobials are designed to be effective for a predetermined period of time. An older antibiotic can't exert any effects on a new microbial strain. There is a different antimicrobial designed for every strain of bacteria. As a result there is no crossover in action due to selective targeting. The body filters antimicrobial compounds to interact with their target microorganism. Until research determines how to control this, antimicrobials will only ever have a very discrete range of targets.Responsibility of DOH in implementing hazard pays to medical workers.True or False? One of William Farr's contributions to public health and epidemiology included the development of a more sophisticated system for codifying medical conditions.
- Differences between Gram + and – and examples. Describe at least two diseases for each, signs, symptomsAn advantage of a point-of-care (POC) test is that effective antibiotic therapy can begin without a delay of waiting for off-site laboratory results. detection of multiple infections is more likely. clinicians are able to diagnose diseases based on clinical signs and symptoms alone. health care workers have a lower risk of exposure to pathogens.Experts please provide good explanation. Not satisfied