In a sequence of amino acids, a non-polar amino acid is mutated into a polar charged amino acid. Which of the following describes what levels of protein strucutures/folding is affected by this mutation? Primary, secondary, tertiary, quaternary Secondary, tertiary, quaternary Primary, Secondary, Tertiary Primary, Secondary

How many amino acids (aa) does your protein have? 1,106 aa 551 aa 1,367aa 508aa 1,210 aa   Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg…

If you have the same protein loaded in two different lanes of an SDS-PAGE stained with Coomasie blue, and one lane has a darker, thicker band of protein than the other lane, can you say that there is more protein in the lane with the darker band? Why or why not?

Alpha-helices and beta-pleated sheets are formed during this stage of protein folding.     Secondary     Primary     Tertriary     Quanternary

What general structural feature is shared by proteins that specifically form homodimers (but not homotrimers, homoteramers etc)? Only one answer is correct.     the surface consists of hydrophilic alpha-helix.   the surface is highly modified by post-translational modification.   the surface is permanently bound by chaperones.   the surface is unstructured.   the surface, or part of it, is self-complementary.

Explain how polypeptides are arranged to form the primary, secondary and tertiary structure of a protein how mutations can cause a change in the sequence of amino acids of a polypeptide? Compare the effects of addition/ deletion mutations and substitution mutations