mRNA: amino acids: traits: DNA: | CGA CAA CAC | GTA GTA | CAA AAA ATG | TTA TAG AAT GAC GGG TGG | mRNA: amino acids: traits: DNA: mRNA: amino acids: traits: arch TTA TTG TTA CGG | AAA AGA CCT | GCA GCC TTG TGT | O 10 C w] 58 GR 7 OM O 00
Q: escribe the parasitic cycles of arthropods, including ticks, mites, and bloodsucking insects.
A: Arthropods have jointed appendages. They are characterized by the presence of an exoskeleton made up…
Q: 3. A man heterozygous for both dominant traits of dimples (D) and free ear lobes (E) marries a woman…
A: Introduction Phenotype refers to the observable physical or biochemical characteristics of an…
Q: Environmental input to different sensory systems affects different neuroanatomical pathways.…
A: Sensory pathways are an essential component of the nervous system, allowing us to receive and…
Q: Following administration of an opiate drug, "pain signals" are prevented from getting out of the…
A: Introduction: Opiates are a class of drugs that include natural and synthetic substances such as…
Q: What are the overall inputs (substrates and energy sources) and outputs (products and by- products)…
A: Introduction Cellular respiration is the process by which cells convert the energy stored in…
Q: Two other parents think their baby was switched at the hospital. The mother has blood type “A,”the…
A: The ABO blood type system is a classification system used to categorize human blood based on the…
Q: Give typing answer with explanation and conclusion How do fungi digest their food sources? Select…
A: Fungi are a diverse group of eukaryotic organisms that include yeasts, molds, and mushrooms. They…
Q: 1. two types of marine mammals including (A) basic characteristics, (B) what they eat, and (C)…
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: 25. The combination of alternating dark A bands and light _______________ bands gives a muscle fiber…
A: Introduction Muscle contraction is the process by which muscle fibers generate tension or force in…
Q: What arethe three main checkpoints involved for both Mitosis, and Meiosis 1?
A: Cell cycle is a set of events that occur in a cell when it divides and grows. A checkpoint is one of…
Q: All of the following are protozoan diseases of the gastrointestinal tract, acquired by ingesting…
A: Protozoan diseases of the gastrointestinal tract are caused by single-celled organisms and are…
Q: PCR is used. A. all of these B. to solve crimes C. to diagnose genetic diseases D. to study gene…
A: Note:- Please always mention the needed parts in case of multiple questions. Thank you! Polymerase…
Q: Compare and contrast bryophytes (e.g. mosses) and seedless vascular plants (e.g. ferns). What…
A: Mosses and ferns are two groups of plants that have played important ecological roles throughout…
Q: At what stage of fetal development does twinning cease to be biologically possible?
A: Introduction Development refers to the process of growth, change, and maturation that occurs over…
Q: What are two types of weak molecular bonds? Then, describe two examples of how these types of weak…
A: Introduction : Hydrogen bonding : A hydrogen (H) atom covalently linked to a highly electronegative…
Q: In aerobic respiration, does inhaled molecular oxygen (O2) combine chemically with carbon to produce…
A: Both aerobic and anaerobic processes can be used for cellular respiration. It is the method through…
Q: Make recommendations about the future use of the huckleberry plant
A: Huckleberries are a group of small, edible berries that grow wild in many parts of North America.…
Q: What is thermodynamics? Describe the first and second laws of thermodynamics in detail. Describe the…
A: Temperature or heat is referred to as "thermo," while the term "dynamics" refers to the movement of…
Q: A 65-year-old man comes to the physician with a chief complaint of low back pain for the past 6…
A: A systematic process of identifying and evaluating symptoms, medical history, and physical…
Q: Describe the use of anaerobic digesters for producing methane. Define bioremediation. Describe two…
A: As per bartleby guidelines only 3 subparts can be answered. Please post remaining questions…
Q: Stetp by step for each question!
A: Introduction Phenotype refers to the observable physical or biochemical characteristics of an…
Q: What is the way an animal responds to its environment called?
A: Living or biotic elements constitute the biological environment. The biological environment is made…
Q: When it comes to healthcare, why should people even bother with using the internet? How does remote…
A: Health Care: Health care refers to the maintenance and improvement of an individual's physical,…
Q: You are presented with the following clinical scenario: "A 50 year old patient presents with…
A: CD15-positive cells serves as a gauge for the disease's aggressivity and progression. CD15…
Q: Explain how monarch butterflies become toxic to predators. Does the predator die after eating a…
A: The monarch butterfly defends itself from vertebrates using two different techniques. The first…
Q: Which of the following is an example of Genetic drift? A. Red flowers with AA genotype evolve after…
A: Evolution is a steady phenomenon that bring about alteration in life from simple to more complex.…
Q: 0 What is phenotypic plasticity? O When a phenotype is exaggerated in males. O When a phenotype is…
A: Introduction:- Phenotypic refers to the observable characteristics or traits of an organism that…
Q: 1. The garden flower Salpiglosis sinuate ("painted tongue") come in different colors. Several…
A: Given data is as follows: Parents F1 phenotype F2 phenotype Red x blue All red 102…
Q: Give a brief description of how RNAi works in cells specifying the molecules involved
A: RNA interference (RNAi) is a cellular mechanism that controls the stability and translation of mRNA…
Q: i need help finding the the type of metagenomic data that the study gathered in the article and…
A: The article titled "Metagenomics of pasteurized and unpasteurized gouda cheese using targeted 16S…
Q: The following pedigree shows a family in which an inherited condition is apparent. The muscle biopsy…
A: A pedigree chart is the graphical representation of a trait or disease in a family tree. It shows…
Q: Please help me with these questions, more than one answer may be correct: 1) Some of the functions…
A: The ability of living organisms to maintain a relatively stable internal environment despite changes…
Q: An example is pea color in Mendel's experiments. A cross of two homozygotes with different…
A: The segregation of the two alleles of a particular gene into the gametes is described by Mendel's…
Q: Calculate the percentage efficiency of extraction of phycocyanin in sample 3, if the amount of…
A: Phycocyanin is a pigment-protein complex that is found in certain types of blue-green algae, such as…
Q: Karim believes that vaping is not harmful to his lungs. He read some research that suggests that…
A: Introduction The lungs are a pair of vital organs located in the chest that are responsible for the…
Q: Two male deer compete for access to a female by sparring with their antlers. What type of selection…
A: Intrasexual Selection: Intrasexual selection is a type of natural selection that occurs when members…
Q: Illustrate a SARS-CoV-2 virion. Label the ssRNA and the 4 structural proteins. Indicate (write) the…
A: Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has rapidly spread in humans in almost…
Q: Sliding-clamp proteins load polymerase onto the primer and maintain its stable association with the…
A: Answer 1) True. Sliding-clamp proteins, like the proliferating cell nuclear antigen (PCNA) in…
Q: Review the images of the two biomes, the tundra and the taiga. Noti that while there are about 1,700…
A: In ecology, a biome is a large geographic region with distinct plant and animal communities that…
Q: A flask containing an aquatic plant in water is placed next to a light. A sensor that detects the…
A: Chloroplasts are special organelles in plant cells that can convert solar energy into chemical…
Q: future use of the huckleberry plant
A: The huckleberry plant is a wild shrub native to North America that belongs to the Ericaceae family.…
Q: If you wanted to use the molecular clock to estimate times of divergence for phylogenetically…
A: Introduction: A gene is a segment of DNA that contains the instructions for the development,…
Q: provide a full Description of the simiarlities and differences between the fish, pork and beef tap…
A: A tapeworm is a parasitic flatworm that lives in the intestines of animals, including humans. They…
Q: A 54-year-old woman comes to the physician because of painful blisters on the trunk that appeared 3…
A: A skin condition refers to any abnormality or disease that affects the skin. The skin is the largest…
Q: Write the correct Latin names for the major divisions of life. Protists are not included on this…
A: There is no definitive reason why and when life on earth originated. According to Aristotle, life…
Q: Match the chelicerate to its respective identifying character. Araneae Scorpiones Pseudoscorpiones…
A: Chelicerates: Chelicerates are a diverse group of arthropods that include spiders, scorpions, ticks,…
Q: Based on the alignment of these protein sequences below, which [pairs] of the genes appear to be…
A: Based on the alignment of the protein sequences provided in the image, it appears that: SEQUENCE 2…
Q: Do you think some ingrediants in foods, that prolong the life of that food, make it easier or harder…
A: Preservatives: Preservatives are substances added to food and other products to prevent spoilage,…
Q: Question 4 Consider a gene with two alleles, H and J. The table below describes fitness for…
A: This question pertains analyzing fitness and allele frequencies in two gene populations with two…
Q: What aspect of a cell's physical makeup increases gradually as it gets smaller? 2. How could…
A: Bacterial cells are single-celled microorganisms with a simple structure that lacks a nucleus and…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A set of cells that host various DNA fragments collectively representing an organisms entire set of genetic information is a _________. a. genome b. clone c. genomic library d. GMOWhat Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. FluxomeThe main aim of human genome project isa) To identify and sequence of all the genes present in the human bodyb) To introduce new genes to human beingsc) To remove disease causing genes from humansc) To improve techniques of finger printing
- SCRAMBLED WORDS: 1. Arrange the scrambled words to form a term related to genetics. 2. After you have formed the words, describe or define the new terms. ennamoidc plluitem leeasll peissaist helatl llaese dooceacminmI sequence the DNA of 3 people and see variation in my gene of interest as follows: Person 1: ATGCAACAATTTAATAAT Person 2: ATGCAACGACGACGACGACAATTTAATAAT Person 3: ATGCAACGACGACGACGACGACGACGACGACAATTTAATAAT What is the name for this kind of variation?The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And also the mutation type
- Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome 1. a discrete part of a protein that provides a unitof functionb. de novo gene 2. a nonfunctional member of a gene familyc. gene desert 3. the joining together of exons in a gene indifferent combinationsd. pseudogene 4. most frequent residues, either nucleotide oramino acid, found at each position in asequence alignmente. syntenic block 5. set of genes related by processes ofduplication and divergencef. orthologs 6. chromosomal region with the same genes inthe same order in two different speciesg. naturalselection7. genes with sequence similarities in twodifferent species that arose from a commonancestral geneh. consensussequence8. genes that arose by duplication within aspeciesi. gene family 9. genomic DNA sequences containing exonsj. paralogs 10. gene-poor region of the genomek. alternativeRNA splicing11. recently evolved from intergenic DNAsequencesl. protein domain 12. progressive…Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTTGo to the NCBI’s website at https://ncbi.nlm.nih.gov On the database dropdown menu, select “Gene” and search for “RB1.” The first entry should be on the Homo sapiens version; click the gene name. Use the information to answer the following: Go back to the RefSeq (back click once) section in the Gene Database entry for RB1. Click on “NP_000312.2” to access the protein’s amino acid acid sequence information: How many amino acids make up the RB protein? Does this value match your prediction in part d.ii.3? Scroll down to “Features.” List two examples of post-translational modifications that can happen to the RB protein
- The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAGthe following segment of DNA codes a protien. 5' - TGATGATATTCCAgaargGATG AGCaataGCACATTGATA-3Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type of nucleic acid that this sequence represents and the complementary DNA sequence Select one: a. DNA; TACGTTCCAA b. RNA; TACGTTCCAA c. RNA; AACCTTGCAT d. DNA; AACCTTGCAT