observation fungi often grow on leftover food observation fungi such as mold and yeast grow more on leftover bread

Q: Gloc Mytilus Mercenaria Neotrigonia Velesunio Hyridella Castalia Triplodon Etheria Chambardia…

A: Introduction: Glochidia are the larval stage of freshwater mussels, including Quadrula mussels. The…

Q: (5)Baldness is an X-recessive linked trait. Baldness is epistatic to curly hair" which is dominant…

A: Baldness is X-linked and recessive, which means that any male with an X chromosome with a baldness…

Q: Suppose that allele D produces tiny ears and allele d produces normal ears. A heterozygous male with…

A: Introduction  Penetrance in genetics refers to the percentage of individuals with a specific…

Q: Who invented/proposed the use of Punnett square in studying genetics? Give a short description of…

A: Gregor Johannes Mendel was an Austrian monk out Brun Monastery , who studied at Vienna University.…

Q: There may be more than one correct answer The ability of DNA to denature is important for which of…

A: DNA has double stranded structure.The process of breaking down double stranded DNA into single…

Q: Speculate about the following details of mitosis. 1. Why do chromosomes need to condense during…

A: MITOSIS The cell duplication is known as mitosis, one cell divides into two genetically identical…

Q: V V V V Ecosystem service: Provisioning Ecosystem function: Flow of information Ecosystem function:…

A: Introduction  An ecosystem deals with biotic and abiotic factors and their interaction with each…

Q: You will read six articles from databases and assemble an outline, which will be posted in the…

A: Introduction: An artificial womb is a technology used for the growth and development of a fetus…

Q: 11. Why is the control of gene expression so critical for all living organisms? To conserve energy…

A: 11) Why is the control of gene expression so critical for all living organisms? Ans ) all the above…

Q: 8. Which statement/s about RNA is/are true? (Select all that apply.) * RNA is made through the…

A: 8.RNA stands for ribonucleic acid.It act as a genetic material in a viruses.It also play essential…

Q: 2) Deforestation has a crucial impact on the amount of carbon dioxide in the atmosphere. Which…

A: Deforestation has a drastic effect on the amount of carbon dioxide in the atmosphere. Carbon dioxide…

Q: Which amino acid will stop closest to the positive terminal in an anode?

A: Amino acids have a tendency to exist as Zwitter ions. A zwitter ion carries both positive and…

Q: Explain the different parts to the mitochondria

A: Introduction :  Mitochondria is a double-membrane-bound cell organelle. It plays an important role…

Q: The inheritance of Huntington Disease can be explained by the concept of haplosufficiency. Select an…

A: Introduction  Huntington Disease is a neurodegenerative genetic disorder that causes progressive…

Q: Would the biologist agree or disagree with the following statements? a) Since there was no…

A: Introduction :- Habitat refers to the place or type of environment where an organism lives and…

Q: Is there any linkage between aspergillosis and perirectal abscess that his brother had? Does this…

A: Perirectal abscess is collection of pus adjacent to the anus due to bacterial infection. Generally…

Q: An individual with genotype Dd Ee Ff will produce (——- )? different types of gametes. If an Ss Rr…

A: Introduction :- Gametes are specialized cells that are produced during sexual reproduction and are…

Q: 4b) The primary sweetener in Hershey’s special dark zero sugar us ___________________

A: Sweeteners are low-energy compounds that have a sweet flavour but lack the calories or the…

Q: metaphase II anaphase II B Phase C Phase E sister chromatids align at the center of the cell since…

A: Introduction:- Cell cycle is defined as the series of sequential regulated events that involves cell…

Q: What are the mechanisms in which DNA genomes evolve? Discuss two or more and provide examples and…

A: The term "genome evolution" refers to the process by which genetic material changes over time via…

Q: How is it possible Jonathan has the dominant disorder, Huntington’s Disease, if none of his family…

A: Huntington's disease is a medical condition during which nerve cells start to degenerate over time.…

Q: Match the part of a cell from the left column to the best description on the right. Golgi Apparatus…

A: Introduction  Cell organelles are tiny structures within a cell that have specific functions to help…

Q: You have a pea plant with a yellow pea phenotype but do not know if the genotype is homozygous (YY)…

A: The yellow and green alleles, respectively, are designated by the alleles ‘Y’ and ‘y’. ‘Y’ is…

Q: 14. Assume you have the following stock solutions: 1 M Tris-HCl (pH 8.0) 0.5 M EDTA (pH 8.0) Perform…

A: Q.Ans:- Explanation:- Given that there is a need to form 30 ml of TE buffer. TE buffer is a solution…

Q: Tumor suppressor genes O become oncogenes when a "gain-of-function" mutation occurs O are classified…

A: Introduction:- The growth and development of organisms takes place by cell growth & cell…

Q: which scientists discovered that DNA is the "transformation factor"? Darwin and Lamarck Watson and…

A: DNA: DNA is a polymer made up of two polynucleotide chains that coil around one another to form a…

Q: A researcher would like to determine how much influence genes have on the development of traits.…

A: A genetic research is a kind of study of the genes and its function which helps to determine certain…

Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…

A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…

Q: Provide an mRNA sequence and the protein for the following DNA sequence 5'TCC GGT CAT'3

A: When a cell makes copy of RNA from the piece of  DNA, it is known as transcription. Transcription is…

Q: In the early stages the embryos are progresses the embryos ✓each other. As time so the late embryos…

A: A zygote is a diploid structure formed by the fusion and fertilization of gametes from both parents…

Q: 1. Types of DNA damage and their causes.

A: DNA is the nucleic acid present in the cells of the living beings. It is composed of…

Q: Considering that Noor and Hamza do produce a first child and name her Roop, what is the likelihood…

A: PKU (Phenylketonuria) is an inherited disorder caused by a lack of the enzyme phenylalanine…

Q: What is the function of a promoter in gene expression?

A: Transcription is the process through which ribonucleic acid (RNA) is synthesised from DNA. The term…

Q: Design and describe an experiment using celery stalks to demonstrate how certain conditions will…

A: A hypothesis is an assumption formed based on evidence. This is the first step in any investigation…

Q: A- B C D E- Prokaryotic Cell Structure -F 4041 -G -H Match the prokaryotic cell structure to the…

A:

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: answer the 3 parts

A: A phylogenetic tree represents the evolutionary relationship between organisms and their ancestors…

Q: Describe the levels of organisation within the human body

A: The cell is the first level of organisation in the human body. Organs are formed from tissues, which…

Q: Many biochemical reactions are non-spontaneous but are required for living organisms. How can they…

A: Chemical processes known as "biochemical reactions" happen within the cells of living beings. The…

Q: Auricular hypertrichosis is a dominant Y-linked condition. Select an answer and submit. For keyboard…

A: Excessive hair growth in specific areas of the body is called hypertrichosis. It is commonly seen in…

Q: Which one of the following is NOT a characteristic of prokaryotic cells?    Cytoplasm.…

A: INTRODUCTION The oldest single-celled microbes on Earth are prokaryotic cells. Bacteria and archaea…

Q: how did you get 104 as the dilution factor? I got 10-2 as the dilution factor for the CNFL plate

A: The CFU stands for the colony forming units. The formula for calculating the CFU/ml is as follows:…

Q: A cell was isolated from a crime scene. Observations revelated the cell has ribosomes, its DNA is…

A: Prokaryotes and eukaryotes are the two main types of cells found in living organisms. Prokaryotic…

Q: The relationship between SES and health can be described as:   Biological difference  Measure of…

A: People with lower socioeconomic status  (SES) have higher morbidity and mortality rates than those…

Q: Imagine three islands, each with a population of frogs. There are approximately 1,100 frogs on…

A: Introduction  A population is a group of living organisms of the same species that live in the same…

Q: After a meal that contains carbohydrates, blood glucose levels usually rise gradually as…

A: Introduction :  Carbohydrates are a large group of naturally occurring organic compounds that are…

Q: Could you please explain these:   1. Why analyze the unknowns in a (short) serial dilution rather…

A: Introduction: DNA concentration refers to the amount of DNA present in a sample. It is typically…

Q: This diagram shows two homologous chromosome pairs from a mouse after DNA replication. Chromosomes…

A: Cell cycle is series of events. It is responsible for dividing the parents and into daughter cells.…

Q: Out of mackies of scotland honey comb milk chocolate with honey comb pieces, hersheys special dark…

A: The nutritive value of a food refers to the amount of essential nutrients it provides, such as…

Q: A 16-square Punnett is time-consuming to draw out. Dr. Thompson can  easily solve this problem by…

A: A Punnett square is a graphical representation used in genetics to predict the probability of an…

Fungi

Fungi can be single-celled or complex multicellular creatures. They are found in pretty much any natural surroundings; however, they generally live on the land, principally in soil or plant material instead of in the ocean or water. Fungi are the members of the group called the decomposers that live off dead and decaying matters. Fungi assume a significant part in the carbon cycle and its different components. They act as a parasite by causing illnesses like rusts, scabs, or ulcers. In crops, contagious illnesses can prompt critical money-related misfortune for the rancher. An exceptionally modest number of growths cause illnesses in creatures. In people, these incorporate skin illnesses such as competitors' feet, ringworm, and thrush.