Q. You have a double-stranded DNA the sequence of which is the following: ATGGTTCTAGGTAAACCTCAAACAGATCCAACATTAGAG Now, you are doing DNA polymerase reaction using: (i) DNA polymerase (ii) dATP, dGTP, ddCTP32 and dTTP (iii) primer: ATGGTTCTAGGT (underlined) Then, how many types of DNA fragments are you making from this reaction? And, what is (are) the DNA sequence(s)?

Q. You have a double-stranded DNA the sequence of which is the following: ATGGTTCTAGGTAAACCTCAAACAGATCCAACATTAGAG Now, you are doing DNA polymerase reaction using: (i) DNA polymerase (ii) dATP, dGTP, ddCTP32 and dTTP (iii) primer: ATGGTTCTAGGT (underlined) Then, how many types of DNA fragments are you making from this reaction? And, what is (are) the DNA sequence(s)?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 12TYK

See similar textbooks

Similar questions

Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
110.Which of the following best explains the leading daughter DNA strand? A.The gaps within the leading strand are sealed by DNA ligase. B.The leading strand is synthesized by the enzyme primase. C.It is polymerized continuously by DNA polymerase from 5' - 3' direction. D. It is polymerized discontinuously by DNA polymerase from 5' - 3' direction which leaves gaps known as Okazaki fragments.
(c) Draw roughly the comparative electrophoretic mobilities of close circular DNA, opencircular DNA and super coiled DNA, all having the same molecular weight.
Distinguish DNA-dependent DNA polymerases, DNA-dependent RNA polymerases, RNA-dependent RNA polymerases, and RNAdependent DNA polymerases in terms of their templates, products synthesized, and proofreading activity, as discussed in this and previous sections
How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATT
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1a Briefly describe or explain what the term "supercoiling" means in the context of DNA structure. What is the difference between positive and negative supercoiling?
1d) Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather than agarose. Why can't agarose be used for a sequencing gel, as it is for other DNA gel electrophoresis?
34. What direction does DNA polymerase extend and proofread DNA? A. Extend: 5'--3' and 3'--5'; Proofread: 3'--;5' B. Extend: 5'--3'; Proofread: 3'--5' C. Extend: 5'--3'; Proofread: 5'--3' D. Extend: 5'--3' and 3'--5'; Proofread: 5'--3' and 3'--5' E. Extend: 5'--3'; Proofread: 5'--3' and 3'--5'
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
1a) When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?
Sliding-clamp proteins load polymerase onto the primer and maintain its stable association with the template. true or false? DNA polymerases add a deoxyribonucleotide triphosphate to the 3' hydroxyl group of a growing DNA chain (the primer strand). true or false?