Q: ssessment No. T
A: Drugs form an indispensable part of health care system. Drugs play an important role in promoting…
Q: H-O-P-0-H ータ H-C-H H. H-C-H H H H C-H H-C=C-C=C-C- C-C-C-C-C H. H. H. H. H.
A: Water molecule composed of two hydrogen atoms and one oxygen atoms that interact with each other by…
Q: A B- G C- H D E F- I -
A: First picture is the anatomical structure of heart which is a muscular organ with four chambers.
Q: O Pr[A] Pr[B | A]
A: 6. Pr { A} Pr { B | A }
Q: CH3CH2OH +HCOOH
A: Alcohol reacts with many kinds of acid to form esters. When alcohol and carboxylic acid reacts, the…
Q: C-H C-H HO-C-H H-C-H но—с—н HO-C-H H-C-OH н-с—он H-C-OH H-C-OH ČHOH CHOH (d) co, + CH-C-c-OH + I|||…
A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…
Q: There are four codons that encode threonine. Consider the leader sequence in Figure 31.22A. What…
A: Threonine is a type of amino acid. Amino acids are the building block of proteins. These are…
Q: Please ASAP. Thank you OPTIONS a. Arg-Val-His b. Lys-Val-His c. Pro-Gly-Trp d. Met-Leu-Ser…
A: A codon is a trinucleotide arrangement of DNA/RNA that compares to a particular amino acid The…
Q: Explain to Anthony's mother what a clean wound is.
A: A wound is defined as an injury that causes major/minor damage to the dermal tissue and internal…
Q: an you help me with this surgical instruments and equipment identification? I'm little confused to…
A: Surgery is the process of operating the patient. It involves cutting, suturing, and abrading.…
Q: ginine rine ginine cine Third letter DCAG UCAG UCAG
A: There are 64 possible codon out of which 3 codon do not code for any amino acid. Thus 61 codon code…
Q: wwww
A: ECG rhythm interpretation plays a vital role in detecting abnormal cardiac rhythms of the patient.…
Q: -I. H. 8. C.- D, G. E. L'
A: Humans are sexually reproducing and viviparous organisms. Their representative events include many…
Q: Ф a a A Aa Aa A Aa AA and aa.
A: Alleles are alternative forms of genes and can be of two types: dominant and recessive. We use…
Q: Why was Wöhler astonished to find he had made urea?
A: Fredrich Wohler performed an experiment attempting to form ammonium cyanate and through this…
Q: HO CH3 CH3 Gly Ser Gly Ala Gly Ala ZI IZ
A: The protein is formed when different amino acids are joined together by peptide bond. The peptide…
Q: LO B A
A: Introduction The heart is a muscular organ that pumps blood. The heart pumps blood throughout the…
Q: II H3N-CH-C–NH-CH-C-NH-CH-C-NH-CH-C-NH-CH-C¬o II ČH,OH CH2 ČH3 CH2 H3C CH3
A: Proteins and polypeptides are created by peptide bonds, which are produced when an amino acid's NH2…
Q: (A) Mr. a (C) (D) (A) Mr. ar (C)
A: Blood is a specialized connective fluid that flows in the body. There are mainly four types of blood…
Q: Z1 PS K CH 22
A: Cell cycle is of sequential events which is responsible for dividing the parent cell into two…
Q: 21 PS 2F ZS E 22
A: This picture is of Cell division (Anaphase) Mitosis is a type of cell division in which a cell…
Q: a Yit-) + Xee) , were K) IS id. Prove TO is Mavla pocess.
A: Probability with Statistics and iid -- Introduction -- The term random sample and iid are…
Q: O is repli Ois tran: O is dupl O is mut
A: The physical and functional unit of heredity is known as the gene. These are made up of…
Q: Br2 COOH CCl4
A: b.
Q: se glant's see stahce
A: Gymnosperms and angiosperms are seed-producing plants.
Q: OH HO- CH₂OH OH -CH-CH₂ HO-CH- . CH I NH " CH . C=0 (СН2)12 (CH2 10CH3
A: The given molecule has a polar head group in the form of a carbohydrate or sugar moiety and…
Q: O True O False
A: Symbiotic mutualism is a relationship between two organisms in which both the partners mutually…
Q: F10 (PC) or ALT+FN+F10 (Mac). Paragraph Arial 14px
A: Central dogma is the process in which DNA is transcribed in to mRNA is called transcription and mRNA…
Q: A- B -D D- N- M- E G K-
A: The heart of human contains two chamber on right and two chambers on left. The right side.has right…
Q: किठoहेण्रोक ो8 मलेटन्य मेठ वड़ Smpie बकd शfo usta ४ eb0 Tयंल (०) ট) om)०ठकब्ब वकव हानकवारड १००१ ern)…
A: For humans, oxygen is an essential gas. It is essential for aerobic respiration, which generates…
Q: Hyperglycemia hy-per-gly-ce-mia excess of sugar in blood Medical Term Main Entry (Pronunciation)…
A: According to the guidelines we have to answer first 2-3 only question, rest you can ask separately…
Q: Pls answer thank u
A: Genetically modified crop Genetically modified crops(GMCs crops) are plants used in agriculture,…
Q: HO-CH CH II CH Q-CH2CH2N(CH3)3 --=0 동_들 2-0- -CH-CH2 C=0
A: The given structure has a polar head group, and two hydrophobic groups present in it. It means the…
Q: но- В с OH OH HO-P-0 OH Ora HO-P-O- OH OH OH OH OH OH NH NH OH OH OH NM₂ NH "NH₂
A: Nitrogen bases are the aromatic complexes that are found in nucleic acids. These compounds play a…
Q: (а) (b) A F -> E H H
A: Coxa or pelvic bone is made up of 3 bones : Ilium Ischium Pubis
Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…
A: The process of protein synthesis involves two major steps - Transcription Translation During…
Q: Food service in hospital
A: Food service hospital or hospital catering services are vital part of patient care. Food service…
Q: но он OH HỌ HO. H. H.
A:
Q: A: B: D: E:
A: Cells in the fearful system, referred to as neurons, speak with every different in precise ways. The…
Q: А. Adenne B.- В- Cye Quanne Thynane D. C. A.
A: The free hydroxyl on the 3' carbon of the following nucleotide forms an ester bond with the…
Q: I need help label name
A: We know that The development of the embryo and of the fetus during the gestation period is known as…
Q: O a. E + S =E O b. E + S =P O c. E + S = P + E O d. S = E + P
A: Enzymes are proteins which increase the rate of a biochemical reaction. There is specific site in an…
Q: ATG CCA GGC GGC GAG AGC TTG CTA ATT GGC TTA TAG
A: This is the physiological process by which the message of DNA in the form of bases is copied into…
Q: А. CHO Сно C. сно D. Сно но -H Но -H H OH H- -OH но -H OH но ČH,OH ČH2OH ČH;OH ČH2OH B.
A: Glyceraldehydes C and D lose their optical activity when oxidized by HNO3 as they are not…
Q: O Radiation therapy
A: option 3 is the Answer Radiation therapy uses high-energy radiation to shrink tumors and kill…
Q: Circle the chiral carbons in the following compounds:
A: Chiral carbon is asymmetric carbon atoms that consist of four different atoms attached to a single…
Q: UNSCRAMBLE THE WORDS
A: Genetics is a field of biology that studies genes, genetic diversity, and heredity in living things.…
Q: G I J K D. E F
A: The function of the reproductive system includes 1. Main function of the Reproductive system…
Q: omps prok Euka
A: comparison between prokaryotes and eukaryotes Eukaryotic cells contain membrane-bound organelles,…
TFIID
TFIIA
TFIIH
TBP
TFIIB
TFIIF
TFIIE
Step by step
Solved in 2 steps
- Identify the labeled factors in the figure below (A and B) and indicate the direction of transcription. ts A O A= Mediator, B= TFIID; direction is into the screen O A= TEIIE, B= TFIIH; direction is into the screen rences A= TBP, B= TEIIB; direction is out of the screen O A= TFIIF, B= TFIIE; direction is out of the screenA pre-initation complex (PIC) is required for transcription to begin. State which TFII protein has catalytic function.Regarding the trp operon: when levels of tryptophan are low, the ___ hairpin forms, resulting in _____ of transcription. Group of answer choices 2-3; termination 3-4; termination 3-4; continuation 2-3; continuation
- Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? Q) Would there be an effect on translation of changing the fourthT in the template strand to a C? If so, what effect?Once an RNA polymerase has initiated transcription, it will release the sigma factor or sigma subunit and bind other proteins known as elongation factors before it begins moving down the DNA template doing strand elongation. Briefly explain why this is necessary - why can't RNA polymerase + sigma factor do all of transcription? Be specific.The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'
- This diagram shows a double-stranded section of DNA. The arrow indicates location and strand of the transcription start site. The direction of transcription is also indicated. In which box would you find a 5’TATAA \3’ promoter sequence that would be used for initiating transcription at the start site shown? a) Box A b) Box B c) Box C d) Box DWrite out the sequences of the two conserved elements in the following bacterial promoter. The startpoint of transcription is shown in red. CACTTTACAGCGGCGCGTCATTTGATATGATGC GCCCCGCT(c) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to suppress syn- thesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix – (reverse) turn – helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein, a different type of repressor protein. A diagram of the trp repressor dimer is also shown. reverse turn trp helix 4 70 Trp -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly- Ile- Prl -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr- Val- Pri heilix trp helix 5 80 90 Trp Ala-Thr-Ile-Thr-Arg-Gly-Ser sgn-Ser-Leu-Lys-Ala-Ala- Prl Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- Prl helix
- Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -TerminationOnce an RNA polymerase has initiated transcription, it will release the sigma factor or sigma subunits or bind other proteins known as elongation factors before it begin moving down the DNA template doing strand elongation. Briefly explain why this is necessary - why cant RNA polymerase + sigma factor do all of transcription?The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′