The cells shown in the image are from a rare species of plant and illustrate different stages of mitosis or meiosis. <> Determine the diploid number of chromosomes (2n) in this species of plant. diploid number of chromosomes: Match each cell to the specific stage of meiosis or mitosis, the number of chromosomes, and the number of DNA molecules per cell. Stage Chromosomes DNA molecules

The cells shown in the image are from a rare species of plant and illustrate different stages of mitosis or meiosis. <> Determine the diploid number of chromosomes (2n) in this species of plant. diploid number of chromosomes: Match each cell to the specific stage of meiosis or mitosis, the number of chromosomes, and the number of DNA molecules per cell. Stage Chromosomes DNA molecules

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter6: Cytogenetics: Karyotypes And Chromosome Aberrations

Section: Chapter Questions

Problem 1QP: Analyzing Karyotypes 1. Originally, karyotypic analysis relied only on size and centromere placement...

See similar textbooks

Similar questions

A cell has two pairs of submetacentric chromosomes, which we will call chromosomes Ia, Ib, IIa, and IIb (chromosomes Ia and Ib are homologs, and chromosomes IIa and IIb are homologs). Allele M is located on the long arm of chromosome Ia, and allele m is located at the same position on chromosome Ib. Allele P is located on the short arm of chromosome Ia, and allele p is located at the same position on chromosome Ib. Allele R is located on chromosome IIa and allele r is located at the same position on chromosome IIb.a. Draw these chromosomes, identifying genes M, m, P, p, R, and r, as they might appear in metaphase I of meiosis. Assume that there is no crossing over.b. Taking into consideration the random separation of chromosomes in anaphase I, draw the chromosomes (with genes identified) present in all possible types of gametes that might result from this cell’s undergoing meiosis. Assume that there is no crossing over.
If we call the amount of DNA per genome “x,” name asituation or situations in diploid organisms in which theamount of DNA per cell isa. xb. 2xc. 4x
Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.
Choose the phrase from the right column that best fitsthe term in the left column.a. DNA polymorphism 1. DNA element composed of shorttandemly repeated sequencesb. phase 2. two different nucleotides appearat the same position in genomicDNA from different individualsc. informative cross 3. arrangement of alleles of twolinked genes in a diploidd. ASO 4. location on a chromosomee. SNP 5. a DNA sequence that occurs intwo or more variant formsf. DNA fingerprinting 6. a short oligonucleotide that willhybridize to only one allele at achosen SNP locusg. SSR 7. detection of genotype at anumber of unlinked highlypolymorphic locih. locus 8. allows identification of a gamete asrecombinant or nonrecombinanti. compound 9. all exons in a genomeheterozygotej. exome 10. individual with two differentmutations in the same gene
For each of the following, decide if it could be appropriatelydescribed as a genome:A. The E. coli chromosomeB. Human chromosome 11C. A complete set of 10 chromosomes in cornD. A copy of the single-stranded RNA packaged into humanimmunodeficiency virus (HIV)
Draw a chromosome and a pair of homologs (or homolog pairs, or homologous chromosomes). Label on the chromosome and homologous pair; the centromere and sister chromatids. In each of these drawings explain how many and where are the Watson and Crick double strand DNA molecules. 2.Diagram of the cell cycle (not cell division) for an organism with two chromosomes (n=2, 2n=4). Include; interphase (including the G1, S, G2 phases), mitosis and cell cycle checkpoints. 3.For an organism with 4 chromosomes draw: a. Metaphase of Mitosis, b. Metaphase of meiosis I, Metaphase of meiosis II.
What is a genome? Describe the following terms/structures as they pertain to a eukaryotic genome: diploid, haploid, gamete, homologous chromosomes, locus, and genes
Compare and contrast the following terms: a. Eukaryotic and prokaryotic cells b. Gene and allele c. Genotype and phenotype d. DNA and RNA e. DNA and chromosome
Analyzing Karyotypes 1. Originally, karyotypic analysis relied only on size and centromere placement to identify chromosomes. Because many chromosomes are similar in size and centromere placement, the identification of individual chromosomes was difficult, and chromosomes were placed into eight groups, identified by the letters A to G. Today, each human chromosome can be readily identified. a. What technical advances led to this improvement in chromosome identification? b. List two ways this improvement can be implemented. c. What clinical information does a karyotype provide?
Why do eukaryotic cells need to go through the elaborate procedure of mitosis rather than simply dividing during interphase? Select as many answers as apply. 1.Daughter cells must be genetically identical to the mother cell, for homeostasis and ordered tissue growth. 2.Bivalent chromosomes must condense and be separated in an orderly fashion, to allow equal distribution of copies into daughter cells 3.Physically dividing the nucleus during interphase would likely lead to gross chromosome breakage and highly unequal assortment of genetic information into daughter cells. 4.Dividing the nucleus during interphase would have the same outcome as mitosis 5.Daughter cells must have half the number of chromosomes after mitosis than the mother cells 6.The homologous pairs of chromosomes need to be separated, to ensure copies go to the daughter cells.
Two nonhomologous chromosomes have the following segments, where * represents the centromere: *ABCDEFG , *RSTUVWX. Name the type of chromosomal rearrangements that would produce each of the following chromosomes. *ABABCDEFG , *ABCD , GFEDCBA*RSTUVWX , *RSWVUTX , *ABCWX , *RSTUVDEFG . Which of these types of abnormalities are most likely embryonic lethal and which ones are not usually a problem for the individual carrying them? Briefly explain why.
The karyotype consists of the number and structure of the chromosomes.How do changes in the karyotype evolve?