were the three pl... G Free Printable D 1 2 CA 4 5 6 7 8 9 In response to high blood calcium levels, the hormone that is released, and the number of the gland that releases the hormone, respectively is: O a. calcitonin and structure 4 O b. calcitonin and structure 3 O c. PTH and structure 4 O d. PTH and structure 3

Q: You cross pure breeding plants with short stamens and white flowers to plants (also purebreeding)…

A: Map distance reflects the physical distance between two genes or two alleles. The genetic map is…

Q: To describe how fungi affect the human health.

A: Fungi are heterotrophs, meaning they rely on organic substances for energy and carbon. Nutrients are…

Q: The oxygen species found in the respiratory burst are contained to inside a neutrophil. O True False

A: Respiratory burst is the production of large number of oxygen species when phagocytosis of microbes…

Q: (f) Parts of a Neuron A Axon (initial C E B segment) G H Synapse: The region where an axon terminal…

A: Neurons (also known as neurones or nerve cells) are the basic units of the brain and nervous system.…

Q: What are some of the differences between the Moderna/Phizer vaccines and the Johnson & Johnson? Why…

A: A vaccination is a biological preparation that confers acquired immunity against a specific…

Q: Screening mammography to detect early breast cancer in women experiencing no symptoms .A True .B…

A: Mammography A tool to diagnose breast cancer by using low energy level of X rays.

Q: 1.Name the vegetative propagules in the following: (i) Agave (ii) Bryophyllum

A: Reproduction is a process of formation of new organism from already existing organism . Reproduction…

Q: The significance of symbiotic associations involving fungi, including lichens, mycorrhizae, and…

A: Microscopic creatures are referred to as microorganisms. Bacteria, archaea, protozoa, algae, fungi,…

Q: What is the function of the axon? to receive information and information into the cell body to store…

A: The neuron is the functional unit of the nervous system. The neurons send and receive signals from…

Q: Consider the recent introduction of wolves into Yellowstone National Park. explain how reintroducing…

A: Wolves play an important role in maintaining the health of ecosystems. They aid in the control of…

Q: Many bacteria and other organisms can live without oxygen.  What steps of cellular respiration do…

A: The oxygen is the colourless, odourless, gaseous element represented by the symbol “O”. It…

Q: Plant-based foods such as fresh fruits, vegetables, legumes, and whole grains and vegetarian eating…

A: d all of these  Plant based diet can improve gut health in about 5  days . Legumes , Vegetables are…

Q: Suggest how the weak points of the Molisch test for carbohydrates can be strengthened by comparing…

A: Introduction  Carbohydrates, often known as sugar molecules, are sugar molecules. Carbohydrates are…

Q: It seems that the expert answer touches on many points, but does not address the question precisely,…

A: Introduction  Proto-oncogenes are a set of genes that, when altered, lead normal cells to become…

Q: The hematoma illustrated in the drawing shown is most likely to be due to tearing of which of the…

A: A blood clot within the skull is known as an intracranial hematoma. The rupture of a blood artery…

Q: Which type of base pairs take the most energy to break in a DNA double helix? a. A-T base pairs b.…

A: DNA replication is a process in which DNA makes copies of itself with the help of the enzyme DNA…

Q: How would poor oral hygiene impact a person's teeth? (easy and simple)

A: Oral hygiene is the activity of brushing one's teeth (dental hygiene) and cleaning between the teeth…

Q: When Mendel crossed in his P generation a yellow-seeded and green-seeded pea plants, all the…

A: As in F1 generation,all the pea plants have yellow seeds.This means that In pea plants,allele for…

Q: A)Identify the bone B)What is the name given to area the arrow points to. C) Name one joint this…

A: The arms are the part of the skeleton, which include the bones of upper arm, firearm, wrist joints,…

Q: 6.6 Describe crossing over. Explain how it is related to recombination

A: Ques : Describe crossing over. Explain how it is related to recombination

Q: Match the granule with their function. ✓ Azurophilic Specific Gelatinase Secretory vesicles A.…

A: Granulocytes have specific granules structure in their cytoplasm. These cells are involved in innate…

Q: A form of deafness is passed on in a large family in an autosomal recessive pattern. A woman in the…

A: There is 75% probability that woman have deafness allele.

Q: Use the following information to answer the next three questions Northern Leopard Frog (Rana…

A: The population is the collection of all the interacting individuals of a single species that are…

Q: Write advantage and drawbacks of RISA (Ribosomal Intergenic Spacer Analysis) technique. What is the…

A: Ribosomal Intergenic Spacer signifies the intergenic region between the small and large subunits of…

Q: Distinguish between cis and trans allele arrangements.

A: As per Mendel 's law of independent assortment, gene basically for two traits get set apart…

Q: 3-week-old male newborn who was delivered vaginally at 33 weeks' gestation has a bulging anterior…

A: A shunt is a flexible tube or catheter which is specifically placed in a specific position in the…

Q: hat kind of information That is the application is derived from polyphasic taxonomy? of polyamines…

A: Taxonomy can be defined as the process of classification on the basis of organisms characteristics.…

Q: What sort of cellular changes would you expect a sailor sick with scurvy to experience? O Their…

A: Introduction: Vitamin C insufficiency is known as scurvy. Anemia, debility, tiredness,…

Q: 35. A 40-year-old woman comes to the office because of a 3-week history of severe, sharp pain near…

A: Introduction  Pain is an unpleasant sensation that indicates that something is wrong. It can be…

Q: Below is a partial pedigree of hemophilia in the British Royal Family descended from Queen Victoria,…

A: Introduction :- Hemophilia is a bleeding ailment that is passed down down the generations. Blood…

Q: Could you also explain how DNA fingerprinting becomes a disadvantage as it pertains to relatives or…

A: Introduction  DNA fingerprinting is a laboratory technique that uses the nucleotide sequences of…

Q: Hashimoto’s disease is an autoimmune disease where the body’s immune system attacks the thyroid…

A: Introduction  A goitre, also known as a goitre, is a neck swelling caused by an enlarged thyroid…

Q: 33. 32 31 35 34 30- 36 29- 28 37 38 27 39 26 40 25 41 24 42 23 22 21 20 17 18 19 6 15 16 72hr…

A: Embryology is the branch of biology that studies embryogenesis, or the formation of an embryo out of…

Q: In a trihybrid cross, we can tell which class is the double crossover class because: they will be…

A: A trihybrid cross includes parents that are heterozygous for three loci.

Q: Explain different types of reproduction.

A: The biological process by which new distinct organisms, or "offspring," are created from their…

Q: Describe Coronaviruses (genome, structure) .. describe a Coronavirus replication cycle.

A: Introduction :- Coronaviruses are a broad group of viruses that infect humans and cause mild to…

Q: Create a maximum 2-page discussion that details the history of vaccines, their advantages and…

A: An individual may be exposed to an antigen to induce immune response a type of immunity known as…

Q: Which of the following statement(s) is/are true. You can select multiple options. Select all that…

A: Insertion or deletion of 3 or more nucleotides does not cause frame shift mutation. Frame shift…

Q: In squirrels, individuals that are heterozygous for the mutant LDL receptor gene( Fa) begin to…

A: In the case mentioned above, the squirrels experience heart attacks quite early when they have both…

Q: Inflammatory cytokines a. act as opsonins. Ob. are produced only by phagocytic cells. c. facilitate…

A: Immunology is a section of biology that includes the study of molecules, cells, and organs that…

Q: 28. A 62-year-old man has adenocarcinoma with lymph node metastases in the proximal portion of the…

A: Introduction Cancer is caused due to uncontrolled and abnormal division of the cells of the body.…

Q: Excess Fat Excess carbohydrate Excess protein Choose... 4 Choose... Is converted to fat but this is…

A: ​​Fats are also called the 'fatty acids' or 'lipids. Fats in our body are made up of three molecules…

Q: the following statements best describes a relationship between the evolution of multicellular life…

A: First law of thermodynamics suggest that energy can be the be created nor destroyed though it can be…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: EITHER Correct OR Incorrect. 1. Every cell in Clayton's body has the same genome. 2. The genes on…

A: Introduction  Chromosomes are thread-like structures found within the nucleus of both animal and…

Q: 5 Some protozoa have specialized structures that carryout functions similar to those of a…

A: Introduction  Any eukaryotic organism that isn't an animal, plant, or fungus is referred to as a…

Q: Compare and contrast stabilizing, directional and disruptive selection with regard to how each…

A: Introduction  Natural selection is the adaptation and modification of populations of living…

Q: John and Jane each have a sibling with cystic fibrosis, but neither John nor Jane nor any of their…

A: Introduction  Cystic fibrosis (CF) is a genetic condition that affects the digestive system, lungs,…

Q: 6. Which are responsible for the template in the synthesis of proteins which in turn control the…

A: The protein synthesis takes place in the cytoplasm of the cell. The protein synthesis activity and…

Q: 20

A: Embryology is the branch of biology that studies embryogenesis, or the formation of an embryo from a…