What is lignin and its role in plants? Why can reducing the amount of lignin in trees enhance the efficiency of cellulostic-ethanol production? Why can't trees be genetically engineered without any lignin at all?
Q: How can one host's show identify another's?
A: In the dynamic world of hosting shows, one host may find themselves in a situation where they need…
Q: Epiphytic plants grow on top of trees, without harming them. They obtain water and nutrients from…
A: commensalism is type of relationship in between the individuals of two species in which one species…
Q: What is the scientific method involved and risk assessment in an experiment testing the tongue of…
A: The scientific method is a systematic approach used by scientists to investigate phenomena, test…
Q: Bus #2: You head into a stem cell. Ms. Frizzle points out that there is a drug in this cell that…
A: Mitosis seems to be postponed in stem cells that are exposed to medication. A working hypothesis is…
Q: True or false Explain your answer You can observe the thylakoids in a Cyanobacteria with the use…
A: A class of photosynthetic bacteria known as cyanobacteria have internal membrane structures known as…
Q: Pls provide side by side difference of the steps in the synthesis of catecholamines and…
A: Catecholamines are a class of neurotransmitters and hormones that include dopamine, norepinephrine…
Q: Calculate standardised survival (lx), % mortality, and age-specific survival (px) and mortality (qx)…
A: Populations are classes of organisms of an equivalent species living within the same space at an…
Q: Bacteriophage entry into a host cell involves: O a) Endocytosis Ob) Membrane fusion O c) Direct…
A: A bacteriophage, commonly referred to as a phage, is a type of virus that specifically infects…
Q: Discuss the various conditions that must be met for herd immunity to exist
A: Immunity refers to the body's ability to defend itself against harmful pathogens, such as viruses,…
Q: 6. Which of the following is true of aerobic respiration? A) It involves the reduction of oxygen.…
A: Aerobic respiration is a cellular process that occurs in the presence of oxygen and is the primary…
Q: Enhancers promoters changing transcription potential insulator sequence translation distant the same…
A: 1. Enhancers can regulate genes from a distance, and yet they influence expression of only some…
Q: In humans, the recessive allele that causes a form of red-green colour blindness (c) is found on the…
A: In this case, the mother is homozygous with normal colour vision (XN XN) and the father is…
Q: A gram-negative prototrophic bacterium, Wisconsin badgerii, is growing on glutamate as a sole source…
A: Based on Gram's stain, bacteria are classified into Gram-positive and Gram-negative. A large portion…
Q: Choose the process that does NOT produce ATP O Fermentation Aerobic respiration Anaerobic…
A: ATP stands for adenosine triphosphate. It is a molecule found in all living cells and serves as the…
Q: • MOTIVATE: In your own words, explain what you see in the picture below. 團 20OLS:
A: The course of evolution involves a number of unavoidable changes leading to the emergence of new…
Q: Draw and label the veins and arteries of the upper thorax and neck of the cat.
A: Veins are part of the circulatory system and play a crucial role in returning deoxygenated blood…
Q: nvestigate the changes in taxonomy since Linnaeus. Note major changes, such as the recognition that…
A: 1)The field of taxonomy, which involves the classification and categorization of organisms, has…
Q: Define systolic and diastolic blood pressure
A: Blood pressure is the pressure exerted by the blood against the wall of the arteries it is generally…
Q: 5) Identify the different phases illustrated here. Why are there so many that look like the one in…
A: The cell is the basic unit of life and each living organism is made up of cells. The cell keeps on…
Q: Can you explain the experimental procedure from this article? Please explain as if your having…
A: In this work, the role of inositol 1,4,5-trisphosphate receptor (InsP3R) and Na, K-ATPase in the…
Q: 9. Fill in the following table with all of the information learned about organic molecules. a. NOTE:…
A: The living organisms made up of different biomolecules that includes proteins, carbohydrates,…
Q: Why can EMB agar be used to detect the presence of E. coli in particular? Explain the principle of…
A: The bacteria in the laboratory grow under appropriate biochemical and biophysical environments. The…
Q: There is no bioavailable glucose or carbohydrates on Kepler-28d. Given the harsh conditions on…
A: Chemosynthesis is a process where organisms utilize inorganic compounds, such as hydrogen sulfide or…
Q: Which of the following is NOT considered a type of bioelectrical signaling? A) trans-epithelial…
A: Bioelectrical signaling refers to the transmission and communication of electrical signals within…
Q: For questions 1-3; indicate whether the sentence or statement is true or false. If false, rewrite…
A: Living organisms need energy for doing cellular activities and this energy is produced by the…
Q: Cell Cycle. Mitosis. and Meiosis: 19) Draw a cell with 4 pairs of homologous chromosomes (aka a…
A: Meiosis is a reductional division because it reduces the number of chromosome to half in daughter…
Q: Give typing answer with explanation and conclusion A biologist is measuring photosynthesis and…
A: NPP stands for Net Primary Productivity. It is the rate at which primary producers, such as plants…
Q: Species C: ATGTTCGCCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTA…
A: By submitting your query sequence to the chosen database, do a BLASTn search. By comparing your…
Q: which of the following would signal enzymes to produce more energy? there may be more than one…
A: ADP is an important molecule in cellular metabolism and energy production. It is formed when ATP…
Q: Define and describe the histology of the: a. neuron, b. glia and glial fibers c. Nissl substance, d.…
A: Since, multiple questions have been asked which are unrelated, only first question will be answered.…
Q: Put the labels in the correct location on the diagram. (One item will not be labeled) Ribosome…
A: The process of making protein molecules is called protein synthesis. It includes amino acid…
Q: Draw a diagram/figure to explain the conjugation process (e.g. use PowerPoint or draw one by hand…
A: Conjugation is the process of horizontal gene transfer in prokaryotic organisms, in this process…
Q: Over 126 children younger than 7 years of age developed Measles in Gauteng after visiting various…
A: Measles is a highly contagious viral disease that can cause fever, cough, runny nose, and rash. It…
Q: What role does quorum sensing play in cell signaling and how does it impact microbial communities?
A: Quorum sensing is a cell-to-cell communication process that bacteria use to coordinate group…
Q: Classify each situation as density-dependent or density-independent AND explain your reasoning. a.…
A: The group of organisms of same species that are present in a particular area at a particular time is…
Q: Darwin and Wallace's theory of evolution by natural selection was revolutionary because it Group of…
A: Charles Darwin and Alfred Russel Wallace introduced the idea of evolution by natural selection in…
Q: Give typing answer with explanation and conclusion
A: Global warming refers to the long-term increase in Earth's average surface temperature, primarily…
Q: Which of these determines which adaptations in a population are best suited for survival? Group of…
A: The process of natural selection determines which adaptations in a population are best suited for…
Q: A _____ group includes descendant species that share an immediate common ancestor.
A: Monophyletic groups are important in evolutionary biology because they reflect the true patterns of…
Q: Give only typing answer with explanation and conclusion You want to cross horses. We will denote the…
A: The phenomenon of genes being passed from parents to children is referred to as inheritance. Genetic…
Q: Approximately how many kilograms (kg) of carnivore (secondary consumer) biomass can be supported by…
A: This question is related to 10% law. According to this law only 10% of energy is available in the…
Q: In each of the following pedigrees (A, B) by inspection, determine the mode of inheritance involved.…
A: Genetic traits are passed down through inheritance from parents to their offspring, who receive all…
Q: Why is water tested for coliform bacteria rather than for pathogenic bacteria which may be present?
A: Water quality testing plays a crucial role in safeguarding public health and ensuring the safety of…
Q: A population of 20 velociraptors has 4 babies in one breeding season. However, 2 of the older…
A: The population dynamics of any species are critical to understanding its development, survival, and…
Q: Briefly describe the steps involved in the development and approval of a new drug in the United…
A: Before drugs are sold to the common public, a stringent process is utilized to affirm their adequacy…
Q: “Model System For Yeast” can you give a clear concise overview of what this topic is and elaborate…
A: Due to its distinct traits and numerous uses, yeast has attracted a lot of attention in biological…
Q: Give typing answer with explanation and conclusion As a consultant plant pathologist, a commercial…
A: As a consultant plant pathologist, I would suggest the following four possible control measures to…
Q: The order for a client is Robitussin syrup (guaifenesin) 15mL po q.i.d. How many ounces of…
A: Robitussin syrup is a brand name medication that is commonly used as an over-the-counter cough…
Q: A population of 20 velociraptors has 4 babies in one breeding season. However, 2 of the older…
A: The group of individuals of a same species that are located in a particular area at a particular…
Q: When comparing frogs and lizards, having a backbone (i.e. being a vertebrate) is Group of answer…
A: Reptiles and amphibians have various attributes that separate them from one another yet they have a…
Step by step
Solved in 3 steps
- How would a scientist introduce a gene for herbicide resistance into a plant?13. Suppose a biotechnology company has developed a GMO, a transgenic plant that expresses Bt toxin. The company sells its seeds to a farmer under the condition that the farmer may plant the seed, but not collect seed from the plants that grow and use it to produce crops in the subsequent season. The seeds are expensive, and the farmer buys seeds from the company only once. How could the company show experimentally that the farmer has violated the agreement and is using seeds collected from the first crop to grow the next crop?Flavr savr Tomato Golden rice, Roundup ready soyabean In order to generate GM foods mentioned above, various gene transfer methods are required to be conducted on these plants. Discuss on both vector-mediated and direct DNA transfer to deliver foreign genes into plants.
- Why is “Agrobacterium-mediated genetic transformation” in plants described as natural genetic engineer of plants?Genetically Modified Foods The creation of transgenic crop plants using recombinant DNA methods involves the transfer of just one gene or a small number of genes to the plants, in contrast to classical breeding methods in which hundreds or even thousands of genes are transferred at once. Explain why this is true. If fewer genes are transferred during the creation of transgenic crops, why are some people afraid that they are dangerous?BICD100 HW6 Prokaryotic Genetics Question 1. You are interested in three genes in bacteriophage. The recessive mutant alleles cause plaque phenotypes that were creatively named fuzzy, shaky, and purple. Another lab published the following map of the three genes: fuzzy shaky 2.9 17.4 purple To verify the published map, you cross a purple shaky phage strain with a fuzzy phage strain by co- infecting E. coli at a high multiplicity of infection (every bacterium infected with both types of phage). You plate the resulting lysate and analyze the phenotypes of the plaques caused by the progeny phage. a. State the genotypes of the two parent phage strains: b. List all eight of the possible phenotypes that could result from this cross. If 400 phage plaques were examined from this cross, how many plaques of each of the eight phenotypic classes would you expect?
- 52. Papaya plants are very susceptible to the papaya ringspot virus (PRSV), which stunts the growth of the fruit and negatively impacts the taste. By 1995, PRSV wiped out the Hawaiian papaya crop completely and made it impossible to produce papaya commercially. In 1998, Cornell University developed a genetically modified papaya called Rainbow that was resistant to PRSV and introduced it to Hawaii. Currently, 80% of the papaya cultivated in Hawaii is genetically modified to be resistant to PRSV.Which of the following rows identifies the effect of PRSV on the original papaya population and the reason why the population recovered? Select one: a. Effect on the Original Population Reason for Recovery Population bottleneck Some papaya had the PRSV-resistance gene. b. Effect on the Original Population Reason for Recovery Increased gene flow The PRSV-resistance gene had to be artificially introduced to the papaya genome c. Effect on the Original Population Reason…Q11. One of the two genes known to be mutated in cases of Hypokalemic periodic paralysis (which is inherited in an autosomal dominant pattern but known to affect males more often than females) is the calcium voltage-gated channel subunit alpha1 S (CACNA1S). What is known about the gene is recorded here: https://www.ensembl.org/Homo_sapiens/Gene/Summary?db=core;g=ENSG00000081248;r=1:201039512-201112451 Please navigate to the link above and ensure that you click to reveal the transcript table. Then use the information in the table to answer the following question. What is the NCBI accession number (including the version) of the RefSeq Match for the first transcript (CACNA1S-201)? Answer: NCBI accession number (including the version) of the RefSeq Match for the first transcript (CACNA1S-201) is ...Evidence [see P. G. Shiels, A. J. Kind, K. H. Campbell, et al. (1999),“Analysis of telomere lengths in cloned sheep,” Nature 399, 316–317] suggests that Dolly may have been genetically older than heractual age. As mammals age, the chromosomes in somatic cells tendto shorten from the telomeres. Therefore, older individuals haveshorter chromosomes in their somatic cells than do younger ones.When researchers analyzed the chromosomes in the somatic cells of Dolly when she was about 3 years old, the lengths of her chromosomeswere consistent with those of a sheep that was significantlyolder, say, 9–10 years old. (Note: As described in the chapter, thesheep that donated the somatic cell that produced Dolly was 6 yearsold, and her mammary cells had been grown in culture for severalcell doublings before one of the cells was fused with an oocyte.)A. Suggest an explanation why Dolly’s chromosomes seemedolder than they should have been.B. Let’s suppose that a female sheep (like Dolly), which…
- 12 13 14 Which of the following is true of a somatic mutation? A. They are mutations passed on to offspring. B. They occur less often than germline mutations. C. They are mutations in gametes, germ cells or gametocytes. D. They are mutations in cells other than gametes, germ cells or gametocytes. Which of the following best defines a transgenic organism? An organism that has had a portion of its genome deleted An organism that has had a synthetic gene inserted into its genome An organism that has been cross mated with a different organism An organism that has been modified to carry a gene derived from a different organism A. B. C. D. The disease Malaria is caused by Plasmodium. The main structural features of Plasmodium are show below. Nucleus Plasma Membrane Mitochondria K.Quigley 2021 A. Spores. B. Runners C. Binary fission D. Nuclear fusion Polar Ring -Rhoptries Ribosomes From the diagram, what is the most likely method of reproduction used by this organism in the human body?07:12 1 Which of the following statements correctly describes one characteristic of a multigene family? Select one: O a. 가가 O b. O c. O d. A multigene family includes a highly conserved gene found in a number of different species. A multigene family includes a gene whose exons can be spliced in a number of different ways. A multigene family includes genes whose sequences are very similar and that probably arose by duplication. A multigene family includes multiple genes whose products must be coordinately expressed. ones whese products must be bartleby.com VA+ 70°F, a cell cultue is able to graw and divide farever, but after a new mutation is found in the čeus, and the cells are at 99°F, mey Stop dividing after a few generahons.what * 16 ikery disiupted by the mutation for the cells to stop dividing after a few gener ution when Compared to the 70°F when they diide and qrow indefinitely! grown they aure 95°F grown at