Which of the following is/are associated with spontaneous mutation?a. An occurrence of lung cancer due to smokingb. A nonsense mutation in an exon caused by an errorin DNA replicationc. An indel mutation in an intron caused by replicationslippaged. A nonsense mutation in an exon caused by an errorin DNA replication, and an indel mutation in an introncaused by replication slippage

Which of the following is/are associated with spontaneous mutation?a. An occurrence of lung cancer due to smokingb. A nonsense mutation in an exon caused by an errorin DNA replicationc. An indel mutation in an intron caused by replicationslippaged. A nonsense mutation in an exon caused by an errorin DNA replication, and an indel mutation in an introncaused by replication slippage

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 5RQ: The initial mechanism for repairing nucleotide errors in DNA is _____. a. mismatch repair b. DNA...

See similar textbooks

Similar questions

For each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.
Dyskeratosis congenita (DKC) is a rare human genetic disorderaffecting telomere replication. Mutations in the genesencoding the protein or RNA subunits of telomerase resultin very short telomeres. DKC symptoms include bone marrow failure(reduced production of blood cells) and anemia. If symptoms aresevere, a bone marrow transplant may be the only form of effectivetreatment. In one case, clinicians recommended that a 27-yearoldwoman with a dominant form of DKC undergo a bone marrowtransplant to treat the disorder. Her four siblings were tested, andher 13-year-old brother was identified as the best immunologicallymatched donor. However, before being tested, he was emphaticthat he did not want to know if he had DKC. During testing, it wasdiscovered that he had unusually short telomeres and would mostlikely develop symptoms of DKC. Although the brother is an immunologically matched donor forhis sister, it would be unethical for the clinicians to transplantbone marrow from the brother to…
Dyskeratosis congenita (DKC) is a rare human genetic disorderaffecting telomere replication. Mutations in the genesencoding the protein or RNA subunits of telomerase resultin very short telomeres. DKC symptoms include bone marrow failure(reduced production of blood cells) and anemia. If symptoms aresevere, a bone marrow transplant may be the only form of effectivetreatment. In one case, clinicians recommended that a 27-yearoldwoman with a dominant form of DKC undergo a bone marrowtransplant to treat the disorder. Her four siblings were tested, andher 13-year-old brother was identified as the best immunologicallymatched donor. However, before being tested, he was emphaticthat he did not want to know if he had DKC. During testing, it wasdiscovered that he had unusually short telomeres and would mostlikely develop symptoms of DKC. Why might mutations in genes encoding telomerase subunitslead to bone marrow failure?
oslorGulolaculGACu When does DNA replication occur in the cell cycle? Replicate this strand of DNA: ATTCGC TAG GU Aanine Transcribe the same piece of DNA Stop GU Valine Cystelne Stop Use the chart to create the amino acid sequence. Arginine AC Leucine Sorine C UG Lysine Proline Define gene mutation Asparagine True or False? All mutations are harmful. Define chromosomal mutation. Histidine Threonine
Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. OA. AAGAUCGUCGAUCGGUCAUG OB. AAGATCGTCGATCGG TCATG OC. GTACTGGC TAGCTGC TAGAA OD. GUACUGGCUAGCUGCUAGAA
The initial mechanism for repairing nucleotide errors in DNA is _____. a. mismatch repair b. DNA polymerase proofreading c. nucleotide excision repair d. thymine dimers
Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the sequence of the DNA strand that would be replicated from this one. GTACACATCAGATT 2. White the sequence of the messenger RNA (MRNA) molecule that would be transcribed from the DNA strand. 30 GUACACAUCAGAU00 37 38 39 3. State how many codons the sequence specifies. 40 41 42 43 44 4. State how many amino acids the sequence specifies. 45
Which of the following rows identifies the mutated DNA sequence, complementary mRNA sequence, and resulting amino acid in a person with metabolic syndrome? Complementary mRNA Resulting Amino Acid Row A B D. OC. C D. D C Select one: OA A OB B Mutated DNA ATG ATG ACT ACT Metabolic syndrome is a genetic disorder with symptoms such as hypertension, elevated blood cholesterol, and low blood magnesium concentrations. This syndrome is caused by a mutation in which a cytosine nucleotide in the codon ACG is replaced by a thymine nucleotide. Use the following to answer the next AUG UAC ACU UGA Methionine Tyrosine Threonine Stop
A mutant DNA strand was transcribed then translated to proteins. a. What is the protein product of the mutant DNA strand? The sequence of the mutant strand is shown below: 5'-TGCCATAACTGTTCGTACTGGCAAATTGCC-3' 3'-ACGGTATTGACAAGCATGACCGTTTAACGG-5' b. The mutation altered the sequence of the wild type template DNA such that a degenerate codon for a basic amino acid in the wild type was converted to a non-degenerate codon resulting in the sequence for the mutant strand shown. What was the original amino acid? c. Compare the charges and pl of the mutant peptide and the normal (wild- type) peptide at physiological pH?
Directions: Transcribe the mutated DNA sequence in the space provided. The BOLDED nitrogen bases are the mutated insertion. MUTATED DNA sequence: ACC TTA СТА ССТ СТС АТT MRNA sequence: Directions: Now use the codon chart to translate the mRNA sequence into an amino acid chain. Second letter A G UUU UUC UUA UUG UAUTyr UAC. UAA Stop UGA Stop UAG Stop UGG Trp G UCU) UGU Phe UCC UCA UGCCYS Ser Leu UCG CUU CUC CỦA CUG CCU) C CCA CG, CAU CAC, CAA GIn CAGJ CGU His CGC Arg Leu Pro CGA CG AAU AUU AUC Fle AUA AUG Met ACG ACU ACC ACA AGU Asn AAC AGC Ser AGA Arg Thr AAA AAG Lys GAUASP GACS GAA GAG, AGG GCU GCC GCA GCG GUU GGU GUC Val GUA GGC GGA Gly GGG Ala A GUG Glu G Amino acid sequence: Compare the resulting amino acid sequence from the original TYR gene and the mutated TYR gene. What do you notice? Based on what you noticed in this exercise attempt to define mutation: First letter 5UAG DUAG Third letter
a. As a result of the structure of DNA and RNA, replication, transcription and translation are possible. What can nucleic acids do, as a result of their structure, that enables these processes to occur? The figure below shows a simplified schematic representation of a segment of DNA. The DNA is labelled with the numbers 1 – 14 for easy reference. -35 sequence Pribnow box 5' UTR 3' UTR DNA TTGACA TATAAT -35 -10 Gene a Gene B Gene y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 UTR = untranslated region b. At which position on the DNA (number 1 - 14) will transcription be initiated? c. At which position on the DNA (number 1 - 14) will the first signal for translation be found? d. Between which two regions on the DNA will the polyadenylation signal be found? Use the numbers to indicate the region. e. Between which two regions on the DNA will the first Shine-Dalgarno / Ribosome Binding Sequence be found? Use the numbers to indicate the region.
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…