Which of the following regarding RNA secondary and tertiary structure is false? Coaxial stacking is the alignment of two helices separated by a broken backbone, and stabilized by pi-stacking between the terminal base pairs of the stacked helices The hairpin loop is stabilized only by pi-stacking, and is critical for t-RNA in order to display the anticodon bases RNA secondary structure is derived from base pairing interactions, not backbone interactions A pseudoknot is a type of coaxial stack between two discontinuous helices derived from ssRNA-ssRNA interactions A-minor motifs involve a ssRNA-dsRNA interaction where the polyA chain interacts with the minor groove of the dsRNA helix

Which of the following regarding RNA secondary and tertiary structure is false? Coaxial stacking is the alignment of two helices separated by a broken backbone, and stabilized by pi-stacking between the terminal base pairs of the stacked helices The hairpin loop is stabilized only by pi-stacking, and is critical for t-RNA in order to display the anticodon bases RNA secondary structure is derived from base pairing interactions, not backbone interactions A pseudoknot is a type of coaxial stack between two discontinuous helices derived from ssRNA-ssRNA interactions A-minor motifs involve a ssRNA-dsRNA interaction where the polyA chain interacts with the minor groove of the dsRNA helix

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 2CT

See similar textbooks

Similar questions

What RNA base sequence is complimentary to the following DNA base sequence 5'-CATGATTAT-3'? Using the table of codons, give the primary structure of the protein coded for by the RNA sequence: 5’-CCA CGA GGG GAG ACU UAA-3’?
An a helix would be destabilized MOST by ○ a glycine residue adopting alpha-helical backbone dihedral angles ○ interactions between neighboring Asp and Arg residues ○ interactions between two adjacent hydrophobic Val residues O the presence of an Arg residue near the carboxyl terminus of the a helix O the presence of two Lys residues near the amino terminus of the a helix
Changing one amino acid within a protein sequence from a tryptophan to a stop codon would be best classified as Amino acids groups Group Characteristics Names Ala, Val, Leu, Ile, Pro, Phe Trp, Met Ala: A Leu: L non-polar hydrophobic Arg: R Asn: N Lys: K Met: M Asp: D Cys: C Gly: G polar hydrophilic (non-charged) Gly , Ser, Thr, Cys, Tyr, Asn Gln Phe: F Pro: P Ser: S acidic negatively charged Asp, Glu Glu: E Gln: Q Thr: T His: H lle: I Trp: W Туr: Y Val: V basic positively charged Lys, Arg, His A) Conservative missense O B) Nonsense O C) Neutral O D) Non-conservative missense
The diagram to the right illustrates the inter-actions of the amino acid side chains of two a-helical polypeptide strands in a coiled-coil, viewed end-on and projected along the helix axes from the N-terminal to the C-terminal end. Are the macrodipoles of the two a- helices oriented parallel or anti-parallel? For this projec- tion is the positive end of the macro-dipole in the sur- face of the paper or below the surface? f C b g e d a' a d' g b' f'
A DNA-binding protein recognizes the following double-strandedsequence:5′–GCCCGGGC–3′3′–CGGGCCCG–5′This type of double-stranded structure could also occur withinthe stem region of an RNA stem-loop. Discuss the structural differencesbetween RNA and DNA that might prevent the DNAbindingprotein from recognizing a double-stranded RNA molecule.
The following diagram represents one of the Christmas-tree-like structures shown in Figure On the diagram, identify parts a through i. Q. 5′ and 3′ ends of at least one RNA molecule
What is the driving force that promotes secondary structure formation of alpha helices and beta sheets? How is this force arranged to make an alpha helix or beta sheet? What promotes turns or kinks in these structures? You can describe and/or draw it but please show what are the interactions facilitating this effect.
What is a helix-turn-helix motif? secondary structure in which an α helix is separated from a β sheet by a loop supersecondary structure in which an α helix is separated from another α helix by a turn supersecondary structure in which a β sheet is separated from a helix by a turn secondary structure in which two right-handed α helices are intertwined secondary structure in which two left-handed α helices are intertwined
For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?
An anticodon on a TRNA has the sequence 3' UAC 5. What amino acid would it be charged with?
The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'
Draw the molecular structure of a looped RNA with 10 nucleotides, from 3' to 5': AUCGUCGGAU, show the first 3 bases (AUC) form pairs with the last 3 bases (UAG) through hydrogen bond.