Which of the following statements concerning fatty acid oxidation is NOT true? O b. Fatty-acid degradation is often referred to as B- oxidation. O C. The way of fatty acid oxidation was confirmed by Franz Knoop experiment. O e. Fatty acids are degraded 2 hydrogens at a time. O d. Oxidation of fatty acid occurs on the carbon atom B to the carboxyl group. NADH and FADH2 are formed during fatty acid oxidation.
Q: Given the data in the table below and your knowledge of the "chemical standard state" (X) and the…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: 6. A control phospholipid membrane is isolated in which the phospholipid tails all have an 18-C…
A: Phospholipids are major membrane lipids and present as a bilayer structure. It is consist of…
Q: Please calculate the number of ATP that can be generated from one molecule of the fatty acid shown…
A: Most of the body's fatty acids are oxidized by beta-oxidation. The oxidation of fatty acids on the…
Q: The Z-scheme of photosynthesis produces approximately a 3:2 ratio of ATP:NADPH. How does a C4 plant…
A: In chloroplasts, photosynthesis starts when an electron from PSII's (Photosystem II) P680 reaches a…
Q: Given the Fischer projection structure of D-Lasallose below, show the step by step process of…
A: Given to us is a 7 carbon ketose sugar. We can number the carbon atoms as shown below. figure 1 The…
Q: Compare and contrast glycogen synthesis/degradation in muscles as compared with the liver.
A: Glycogen is a storage polysaccharide made up of glucose units linked by alpha 1,4 and alpha 1,6…
Q: The class of enzymes that cleaves most aromatic rings in biological systems is _____________.…
A: Enzymes are proteins that interact with substrate molecules to stabilise the transition state and…
Q: 13. Southern blotting is separation of DNA by agarose electrophoresis and probing with a labeled…
A: The 'blot' in the different blotting techniques (southern, northern, western and eastern blotting)…
Q: Remaining Time: 07 minutes, 13 seconds. * Question Completion Status: closes a potassium channel…
A: Active transport is the transport of substances across the plasma membrane against their…
Q: Make 2 mL of 50 fold dilution of DNA solution and sodium phosphate buffer. DNA: 400 uL Sodium…
A: Dilution is the process of lowering the concentration of a solution by adding more of solvent to it.…
Q: In its non-phosphorylated state, glycogen phosphorylase can be activated by which of the following…
A: Glycogen phosphorylase is the regulatory enzyme of the glycogenolysis pathway. Glycogenolysis is the…
Q: The presence of insulin causes the activation of phosphoprotein phosphatase. This leads to the and…
A: PFK-2 indirectly regulates the rates of glycolysis and gluconeogenesis. PFK-2 catalyzes the…
Q: Serine, cysteine, threonine can participate in hydrogen bonding. Valine cannot. Explain differences…
A: Alpha carbon of amino acids contains amino group, carboxyl group, hydrogen atom and side chain…
Q: e. Write the equations involved in the neutralization process of antacids. (Gastrointestinal Agents)
A: Antacids are medicines that are used to treat acidity. Antacids cure acidity by reacting with acids…
Q: a) L-fucose is also known as 6-deoxy-L-galactose. Note that D-galactose is a C-4 epimer of…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: fatty acid designated as 20:0 is ________, while one that is designated 20:3 D5,8,11 is ________.…
A: Fatty acids are very important class of macromolecules in our body. They are the simplest type of…
Q: A. Effect of Enzyme Concentration Table 1. Effect of Catalase Concentration on Enzyme Activity…
A: "Since you have posted multiple questions, we will provide the solution only to the first question…
Q: What are the effects of amytal and myxothiazol on NADH and FADH2 oxidation, respectively, given that…
A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…
Q: For the net production of a molecule of glucose from CO₂, ribulose-1,5-bisphosphate must react with…
A: Synthesis of glucose from phosphoglycerate occurs through the process gluconeogenesis. ribulose 1,5…
Q: You are interested in cloning a gene that codes for an enzyme that produces a blue pigment. You have…
A: Introduction pUC19 is plasmid vector. Plasmid is a cloning vehicle used in recombinant DNA…
Q: Muscle glycogen phosphorylase, an enzyme that provides glucose to the muscle for energy production,…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 6. Draw the cyclic structure of sucrose; encircle the acetal link; and explain why it is non-…
A: “Since you have asked multiple questions, we will solve the first question for you. If youwant any…
Q: what is does the induced -fit model account for? 2 why are most enzyme inactive at higher…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Compare and contrast the following. Use you own words and be sure to incorporate key biochemical…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: 2. The lipids: a. They are found in high concentrations in cells in free form. b. They have one or…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: How similar of an effect would a mutation in pyruvate dehydrogenase have, compared to a mutation in…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate by…
Q: Structure and Function of Pyruvate Dehydrogenase Q10.2: What is the metabolic logic regarding…
A: Pyruvate dehydrogenase kinase (PDK): It is a kinase enzyme that phosphorylates the enzyme pyruvate…
Q: Glucagon causes production of which activates Insulin causes production of which activates -
A: Glucagon and insulin are hormones released from alpha and bets cells of pancreas, respectively.…
Q: B Which of the following is a Receptor Tyrosine Kinase? a. adenylyl cyclase b. B-adrenergic receptor…
A: Tyrosine kinases are enzyme that phosphorylates their substrate at the tyrosine residue. Tyrosine…
Q: What is the isoelectric point of the following peptide molecule?…
A: The pH at which a specific molecule carries no net electrical charge is known as the isoelectric…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Draw a lipid exhibiting both an ether-linked and ester-linked acyl group attached to a glycerol…
A: Lipids are made up of fatty acids. they are insoluble in water. Lipids are important constituents of…
Q: How does insulin cause an increase in the rate of glucose transport into cells when blood glucose…
A: Insulin is a peptide hormone that helps to maintain the glucose levels in the blood. When there is…
Q: What are ketone bodies and why do they form during fasting?
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: One of the functions of the pentose phosphate pathway is to make NADPH, which plays important roles…
A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…
Q: Two villages in the Amazon depend on corn as a major staple in their diet. People in village A have…
A: Pellagra is a deficiency disease which is characterised by diarrhoea, mental disturbance, scaly…
Q: What is the committed step of pyrimidine biosynthesis? Include the names and structures of any…
A: Pyrimidines are nitrogenous bases found in nucleic acids. Pyrimidines are heterocyclic organic…
Q: What is the role of HCO3 in the activity of pancreatic enzymes? 2. What factors are needed in the…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: What shuttle mechanism transfers the electrons from cytosolic NADH into the mitochondria with the…
A: Mitochondrial inner membrane is impermeable to NADH. Hence, for transfer of NADH, it is first…
Q: Why does glutamate the only amino acid used in oxidative deamination
A: Glutamate is an acidic amino acid that acts as the only amino acid used in oxidative deamination.…
Q: The drug below is used in the treatment of: O Rheumatoid arthritis. O Gram(+) bacterial infections.…
A: Heterocyclic ring is a ring structure made up of different atoms. Given to us a heterocyclic…
Q: Purine synthesis begins with the synthesis of IMP. Beginning with IMP, write the step(s) involved in…
A: Purines provide the essential components for DNA and RNA . They act as building blocks for the…
Q: Reaction of alkaline, acid and enzymatic hydrolysis of triacylglycerols.
A: Triacyl glycerols are triglycerides which are formed from 3 molecules of fatty acids and one…
Q: Biologically important steroids: (sterols – cholesterol and its derivatives, bile acids, steroid…
A: Steroids are derivatives of Cyclopentanoperhydrophenanthrene ring containing compounds. They have…
Q: 1.How many chiral center does D-Eranose have? 2. How many stereoisomer are possible for D-Eranose.
A: Conformation is the different positions a molecule can twist into. Configuration is the arrangement…
Q: Identify examples of a carbohydrate that is: unbranched, reducing monosaccharide
A: Chemically, carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence…
A: Genetic information in our body is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: An in vitro experiment used the isotope 14C-acetyl-CoA to identify 14C- oxaloacetate (OAA) as the…
A: Citric acid cycle - it is also called as Krebs cycle or the TCA cycle (tricarboxylic acid cycle)…
Q: (a) 2,3-Bisphosphoglycerate (BPG) reduces binding of O₂ to hemoglobin from almost hyperbolic to…
A: Hb is a protein responsible for carrying both O2 and CO2 in blood. 1 Hb protein is composed of 4…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following is the chemical end product of fatty-acids metabolized in the beta-oxidation pathway? Select one: a. Beta-carotine b. Free-radicals c. Lactic acid d. Acetyl-CoA e. PyruvateWhich of the following statements is/are TRUE about fatty acid activation before β-oxidation? I. The process consumes energy equivalent to two moles of ATP. II. The fatty acid is activated by ATP to give a fatty acyl-CoA.Which of the following stimulates the conversion of pyruvate to acetyl-CoA? a) Activation of pyruvate dehydrogenase kinase b) A decrease in the ratio of NAD+/NADH c) Bothaandb d) Neither a nor b
- The metabolic function of the pentose phosphate pathway is to: a. generate NADPH and pentoses for the biosynthesis of fatty acids and nucleic acids. b. provide intermediates for the citric acid cycle c. participate in oxidation-reduction reactions during the formation of H,O d. act as a source of ADP for biosynthesisA patient who has been drinking large amounts of alcohol for long periods of time shows thefollowing symptoms: apathy, loss of memory, and a rhythmical to-and-fro motion of the eyeballs.Which of the following reactions are most likely to be affected in the patient? A. Conversation of pyruvate to acetyl-CoA B. Conversation of a-ketoglutarate to succinyl-CoA C. Both A and B D. Neither A nor BThe fats metabolic pathway represented above corresponds to lipolysis (i.e., oxidation of fatty acids) and is a… Question 5 options: a) Catabolic pathway. b) Anabolic pathway. c) Both a catabolic and an anabolic pathway. d) Allosteric pathway. e) None of the above.
- How many NADPH and ATP are used in the synthesis of the C16:0 fatty acid starting from acetyl-CoA and bicarbonate? A. 7 NADPH, 7 ATP B. 8 NADPH, 8 ATP C. 14 NADPH, 7 ATP D. 16 NADPH, 8 ATP E. 14 NADPH, 8 ATPCompare and contrast fatty acid oxidation and synthesis with respect to (a) site of the process (b) acyl carrier (c) reductants and oxidants (d) stereochemistry of the intermediates (e) direction of synthesis or degradation (f) organization of the enzyme systemUpon considering the complete oxidation of one mole of fatty acyl (CoA) of an arachidic acid (20:0). Answer the following lettersa. Rounds of beta oxidationb. total no. of acety CoA producedc. total no. of NADH produced from all rounds of beta oxidariond. total no. of FADH2 produced from all rounds of beta oxidation
- Which of the following statements is/are TRUE about the PPP? A. Most active in cells where lipids are synthesized. B. Reactions involved are oxidative and non-oxidative. C. Also called the hexose monophosphate shunt pathway. D. Occurs in the cytosol.Fatty acid biosynthesis differs from β-oxidation in that: A. NADP+ is used in biosynthesis but not in β-oxidation. B. Biosynthesis uses malonyl-CoA while β-oxidation does not. C. Biosynthesis occurs in the cytoplasm while β-oxidation occurs in the mitochondria. D. Biosynthesis is a reductive process while β-oxidation is oxidation.Citrulline is one metabolite whose levels are “out of range.” The unusual levels of citrulline could be explained bythe loss of function of which enzyme? Draw the reaction catalyzed by this enzyme.