Which organ serves as the storage organ for the excretory system? a stomach b bladder c ureter d kidney

Q: Match the mineral to its main function. chloried insulin enhancement sodium, potassium thyroid…

A: Insulin  A hormone that controls the level of glucose in the blood stream.

Q: Which of the following is true about integral proteins according to the fluid mosaic model? Integral…

A: Introduction According to the fluid mosaic model there are different types of proteins within the…

Q: Describe the ligand for the NK-cell receptor CD94:NKG2A.

A: Introduction: CD94:NKG2A has the following characteristics: a. contains a C-type lectin domain; b.…

Q: Name: - In humans, being a tounge roller (R) is dominant over non voller (r). A man who is a…

A: As per BNED rule only first question should be answered, so kindly submit the other question…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: the liquid viscosity is density intendent. True O False during the diastolic of the cardiac cycle…

A: Introduction  When the membrane potential of a specific cell region rapidly rises and falls, it is…

Q: 20. Activity involving two or more microorganisms seeking the same niche or nutrients. M 26. The…

A: Microbial interaction defines the interaction of a microbe with the other one or with any other…

Q: Match the fat soluble vitamin with the best food source fortified dairy, fatty fish, SUN orange,…

A: Introduction Vitamins are needed for the normal cell function, growth, and development, An…

Q: Give advantages that amoeba has over a lizard in relation to their levels of organization

A: The amoeba being an unicellular organism thus a single cell performs all its body functions but in…

Q: Why monarch butterflies are supposedly toxic?

A: Due to its size and spectacular orange, black, and white pattern, the Monarch butterfly (Danaus…

Q: 7 Use the following images to answer the next two questions. 5 6 Stage 8 in the diagram above is…

A: The given diagram illustrates cell division. There are two types of cell division - mitosis and…

Q: The following chemicals are involved in electron transport. Which of these chemicals has the…

A: Introduction: The electron transport chain, also known as the respiratory chain, is found in the…

Q: To determine: The portion of the fungal body which is represented by mushrooms, puffballs, and…

A: Fungi are responsible for the breakdown of organic materials in plants, such as cellulose and…

Q: Which of the sentences below does not describe an autotroph? a wheat that is used to make flour for…

A: Introduction An autotroph is an organism that is able to form nutritional organic substance from…

Q: wobble

A: The hypothesis which provides the understanding of codon and anticodon base pairing is called Wobble…

Q: How is our concept of human form and function today affected by inventors from the seventeenth to…

A: Introduction :- Humans are the most numerous and ubiquitous primate species, distinguished by…

Q: Why does the hydrolysis of ATP release so much energy?     Because very strong bonds are required…

A: The mechanism of ATP hydrolysis is an exergonic one. It generates adenosine diphosphate (ADP),…

Q: Which microorganism is spore forming which often make septate hyphae and reproduce asexually

A: Introduction :- Most fungi's hyphae are split into cells by septa, which are internal walls…

Q: How many ATP are made in the electron transport chain if Suzy ate 100 molecules of glucose?

A: Introduction  The electron transport chain is a set of four protein complexes that link redox…

Q: de bien Class: Genus: Common Name: Dorsal Ventral

A:

Q: Please compare the design and operation of a protein precipitation unit to that of a chromatography…

A: Protein precipitation is a process in which proteins are removed from solution by the addition of…

Q: 4. In humans the primary purpose of cellular respiration is A the removal of CO₂ from animal cells…

A: Introduction :- The metabolic pathway that breaks down glucose and produces ATP is known as cellular…

Q: 6.4 Write genotypes correctly to indicate if two genes are linked or not and if linked, the…

A: A gene is a basic unit of heredity and a sequence of nucleotides in DNA that basically encodes the…

Q: Place the steps regarding fat digestion and absorption in the correct order. The abbreviation TAG is…

A: Introduction Digestion is the process of breakdown down food into smaller particles that can be…

Q: What is Brain-derived neurotrophic factor (BDNF)? What connection does it have to exercise, nature…

A: Introduction: Brain-Derived Neurotrophic Factor (BDNF) is a signaling molecule that has been linked…

Q: Which of the following molecules are participate in the steps protein synthesis steps in both the…

A: Introduction :- RNA polymerase creates RNA by following a DNA strand. RNA polymerase is an enzyme…

Q: Give an example of a concrete situation, in the human body, which would lead to DNA replication and…

A: DNA replication refers to the production of more copies of DNA using the available DNA as a…

Q: Determine whether or not two genes are linked and explain how you know

A: Genetic linkage is one of the important abilities of the genes present nearly close to each other on…

Q: 23) A 15 year old boy who still displays all the physical charatcerstics of boys 4-5 years younger…

A: Introduction :- Hormones are chemical messengers in the body that deliver signals to the bloodstream…

Q: PATHOLO No 5 TASK No 1 A 24-year-old patient was admitted to a psychiatric hospital with a diagnosis…

A: Hysterical neurosis is the disease that is associated with the nervous disease which affects the…

Q: C Class: Common Name:_ ass: ammon Name:

A:

Q: Why does clumping occur when the Staphylase reagent is mixed with S. aureus cells?

A: Introduction  The ability to produce both free and bound coagulase is a widely recognised…

Q: Some modern ethnic groups (white Europeans and Asians) have apparently inherited genes from…

A: Introduction Studies found that modern human has been influenced by past species.  Scientists found…

Q: 2. Describe each of the trends in primate evolution and why it's beneficial: Description Benefit…

A: Description Benefits Prehensile hands and feet/ opposable thumbs Prehensile tail used as a…

Q: . synaptic vesicles are synthesized in the nerve cell body - TRUE OR FALSE 2.in an electrical…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Compare the ratio of white:black moths in the first generation to much later generations in the…

A: Natural selection can alter the frequency distribution of  alleles and the heritable traits in…

Q: The amino acids of proteins can enter the process of cellular respiration, but first the must…

A: Introduction Cellular respiration is almost always aerobic  but anaerobic can sometimes be relied…

Q: C A T A C G C G T A с G

A: The given figure shows the process of DNA replication. DNA replication refers to the process of…

Q: You are walking down the “tough streets” of New Jersey, and suddenly you feel the need to run away…

A: Introduction  Biological macromolecules are huge molecules that are made up of smaller organic…

Q: STR ⒸDigital Frog International A B

A: Introduction  The heart, blood vessels, and blood are all part of the blood circulatory system,…

Q: 12. What conditions are adverse to the use of phytoremediation?

A: Introduction Phytoremediation is a plant-based approach to remove or reduce the amount of…

Q: You cross pure breeding plants with short stamens and white flowers to plants (also purebreeding)…

A: Map distance reflects the physical distance between two genes or two alleles. The genetic map is…

Q: How does genetic analyses of fossils help us understand human evolution better than just examining…

A: following is description of how genetic analysis of fossils help understanding human evolution…

Q: Which of the following interactions in E. coli ensures that the start codon of an mRNA is accurately…

A: The translation is the process of producing protein mRNA as a template and peptidyl activity of the…

Q: Clearly distinguish between the terms diffusion and osmosis.

A: Introduction: Osmosis and diffusion are two types of passive transport that are important for…

Q: Charcot-Marie-Tooth disease (CMT) is a heritable condition characterized by weakness in leg, foot,…

A: Answer-- The myelin in the motor neurons is damaged thereby preventing an impulse from moving along…

Q: Write advantage and drawbacks of RISA (Ribosomal Intergenic Spacer Analysis) technique. What is the…

A: Ribosomal Intergenic Spacer signifies the intergenic region between the small and large subunits of…

Q: What are the major ecosystems of the world? Describe forest and pond ecosystems in detail

A: Ecosystem  A geographical area in which plants, animals, & other species, as well as weather…

Q: 2. The rising of nanotechnology paved way to discover new trends, one of which is the discovery of…

A: The proteins are formed when ribosomes read an mRNA. The base triplets or codons on the mRNA are…

Q: Q3) Explain the different classification of plasmids

A: Introduction Plasmids are the extra chromosomal DNA found in bacterial cell. Plasmids are small,…