Concept explainers
Videos
Figure 15.11 A scientist splices a eukaryotic promoter in front of a bacterial gene and inserts the gene in a bacterial chromosome. Would you expect the bacteria to transcribe the gene?
To analyze:
Whether the bacterial gene having eukaryotic promoter gets transcribed or not.
Introduction:
Eukaryotic promoters are different from prokaryotic promoters so the bacteria would not transcribe the gene.
Explanation of Solution
In case of transcription of genes, i.e. formation of RNA (mostly m-RNA) from DNA, promoters play an essential role. Promoters are the specific DNA sequences present near the starting point of transcription of a particular gene. Promoters help in the binding of RNA polymerase and transcription machinery to the specific point in the gene to initiate the process of transcription. They are mainly located upstream of a gene, towards 5’ end of the anti-sense strand. As these are specific recognition sequences, eukaryotic promoters are different from prokaryotic promoters.
Prokaryotic promoters have three essential elements:-10 elements,-35 element and UP (upstream promoter) element.
Eukaryotic promoters mainly contain a TATA box of six nucleotides (consensus sequence is 5’ TATAAA 3’) located around-30 (with reference to initiation site of transcription +1), while prokaryotic promoters have its counterpart-10 elements or Pribnow box of six nucleotides (consensus sequence is 5’ TATAAT 3’) located at-10. Both these have A-T rich elements. Prokaryotes also have one more promoter sequence of six nucleotides at-35 which is (5’ TTGACA 3’) called as-35 elements. Pribnow box or-10 element is essential in prokaryotes for the initiation of transcription and-35 element helps in increasing the transcription rate.UP element is A-T rich sequence located between-40 to-60.
Other conserved sequences in eukaryotic promoters are CAAT box (GGCCAATCT) around-80 and GC-rich boxes (GGCG), and octamer boxes (ATTTGCAT) located further upstream.Basically, eukaryotic promoters are much more complex and larger in structure than the prokaryotic promoters.Sigma factor (s factor) of prokaryotic RNA polymerase holoenzyme recognizes and binds to the promoter interaction site to initiate transcription.
So, a bacterial gene having eukaryotic promoter would not transcribe because eukaryotic promoter has different recognition sites/consensus sequences than the required prokaryotic recognition sites. RNA polymerase, transcription factors and other proteins of host bacterial chromosome would not be able to identify the eukaryotic promoter sequences and transcription of the gene would not occur.
So, the bacteria would not transcribe the gene with the eukaryotic promoter as they are different from the prokaryotic promoters.
Want to see more full solutions like this?
Chapter 15 Solutions
BIOLOGY 2E
Additional Science Textbook Solutions
College Physics
Concepts of Genetics (12th Edition)
Campbell Essential Biology with Physiology (6th Edition)
Fundamentals of Anatomy & Physiology (11th Edition)
Anatomy & Physiology
- Put the following processes in order of their occurrence during expression of a eukaryotic gene: a. mRNA processing c. transcription b. translation d. RNA leaves nucleusarrow_forwardA bioengineer takes the gene from the human liver cell and insert into a bacterial chromosome. Then, bacteria transcribe this gene into mRNA and translate this mRNA into protein. This protein produced is useless and has been found to contain more amino acid than the protein made by the eukaryotic cell. Please explain the reason for that issue.arrow_forwardThe diagram below shows a section of double-stranded DNA undergoing both transcription and replication. RNA polymerase (gray oval) is bound to the transcriptional template strand and moving from left to right (arrow). The resulting RNA transcript is also shown (dotted line) with limited base pairing to the template strand. The DNA sequence is specified for a portion of the double-stranded DNA.arrow_forward
- Several different nucleic acids are involved in the process of getting a protein produced from a gene. DNA contains the "genetic code" for the protein. DNA is double-stranded, but only one strand is transcribed into MRNA. The MRNA then goes into the cytoplasm where it is translated into protein with the help of TRNA. At each stage of the process, there is base complementarity (A pairs with T/U and C pairs with G) between the nucleic acids involved to ensure the integrity of the DNA blueprint for the protein being produced. Therefore, some of the four strands of nucleic acids involved will match (except U replaces T in RNA) and some will have base complementarity. Indicate whether there is matching (1) or base complementarity (2) between the following nucleic acids. DNA sense strand and MRNA DNA sense strand and tRNA DNA antisense strand and MRNA MRNA and TRNAarrow_forwardWhich one of the following features could you use to determine the length of the RNA that is produced based on the gene, before it is processed? The exon and intron sequences The promoter and enhancer sequences The start and stop codons for translation The transcription start and termination sequencesarrow_forwardA bioengineer takes the gene from the human liver cell and insert into a bacterial chromosome. Then, bacteria transcribe this gene into mRNA and translates this mRNA into protein. This protein produced is useless and has been found to contain more amino acids than the protein made by the eukaryotic cell. Please explain the reason for that issue.arrow_forward
- A scientist is trying to get a bacterium to make human insulin. The scientist uses restriction enzymes to cut out the human gene. They use the same restriction enzyme to cut the bacterial DNA so the two sections of DNA can connect. Then they used ligase to seal the backbones together. The bacteria is allowed to grow and produce proteins. But for some reason, the insulin gene is being transcribed and translated but for some reason the protein is nonfunctional. What is the source of the problem? How can this be fixed? (this will require some research on the internet about cDNA)arrow_forwardAnswer the question in the attached picture:arrow_forwardThe sequence below is DNA from an unknown cell. Use what you know about transcription to infer some things about the cell it came from and the RNA product it will form. 5’ – AGATTCAGGTCGAACATTATAGTCCAACTATACGGCGTTATGTCAATCCGCA – 3’ 3’ – TCTAAGTCCAGCTTGTAATATCAGGTTGATATGCCGCAATACAGTTAGGCGT – 5’ Which is the template strand (top or bottom)? Possible Answers: A. Top - Where the TATA box is found B. Bottom - Opposite where the TATA box is found C. Bottom - Where the holoenzyme RNA polymerase attaches to the promoter D. Top - Opposite of where the holoenzyme RNA polymerase attaches to the promoterarrow_forward
- The sequence below is DNA from an unknown cell. Use what you know about transcription to infer some things about the cell it came from and the RNA product it will form. Be sure to explain your answer for each question. 5’ – AGATTCAGGTCGAACATTATAGTCCAACTATACGGCGTTATGTCAATCCGCA – 3’ 3’ – TCTAAGTCCAGCTTGTAATATCAGGTTGATATGCCGCAATACAGTTAGGCGT – 5’ Which direction is upstream (left or right)? Possible Answers: A. Right - the promoter lies downstream of the transcription start site B. Left - the promoter lies upstream of the transcription start site C. Right - the promoter lies upstream of the transcription start site D. Left - the promoter lies downstream of the transcription start sitearrow_forwardDraw a typical bacterial mRNA and the gene from which it was transcribed. Identify the 5′ and 3′ ends of the RNA and DNA molecules, as well as the following regions or sequences: Q. Promoterarrow_forwardTranscription is the first step in gene expression. It involves copying a gene's DNA sequence to make an RNA molecule. It is performed by enzymes called RNA polymerases, which link nucleotides to form an RNA strand (using a DNA strand as a template). Transcription has three stages: initiation, elongation, and termination. What is the difference between Rho Dependent and Rho Independent termination in prokaryotes?arrow_forward
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning