Q: Can you help with these
A: The gene is the nucleotide sequence that is present in the DNA, and codes for a specific functional…
Q: A woman with no phenotype is known to have a 14:21 translocation. Please answer questions 1 and 2.…
A: Between two acrocentric chromosomes where the centromere is at one end of the…
Q: What is the difference between opiates and opioids?
A: Opioids These are the drugs, which bind to specific opioid receptors present in our central…
Q: Figure 2g. Section of the Liver (Sinusoid at LPO) 5e. Describe the type of epithelium: Figure 2h.…
A: The type of cells that line the inside and outside of various parts of the body is called epithelial…
Q: 7. An inversion heterozygote has the following inverted chromosome: Centromere A B JI HGF ED…
A: Crossing over is an event in cell division where two parental chromosomes come close and synapses…
Q: Think about the ways we define/identify a species. What would the least precise way to determine a…
A: According to the Biological Species Concept, a species is defined as a group of organisms that can…
Q: 15) Which of the following can disrupt gene expression? A) microRNAs B) a repressor protein C) mTORS…
A: Explanation: 15) Option a: By forming a binding complex with messenger RNA (mRNA) in the cell…
Q: dentify the following by placing an "X" in the correct place: 1) Distal end of the humerus 2)…
A: The humerus is the longest and largest bone of the upper limb. It consists of a proximal end, a…
Q: Synapomorphic characteristic of monophyletic group of chondrichthyes and bony fishes
A: A synapomorphic character is shared by some taxa but not others because the former inherited it from…
Q: In the lake the biomass of plankton decreased from 65000 to 50000 kg. As a result the biomass of the…
A: In the food chain, one organism eats another. The first trophic level is of producers which include…
Q: Discuss the relationship between protooncogenes and tumor suppressor genes and cancer. ( no intro…
A: Cancer is a disease in which some of the body's cells grow uncontrollably and spread to other parts…
Q: The method of applying the molecular clock to determine the timing of the most recent common…
A: Introduction Our immune system plays key role in defence against harmful foreign particles be it…
Q: The ECG records the electrical stimulation of cardiac muscle by system and not the conduction the…
A: Heart The special muscular organ of the body which is made by special type of muscles cells known…
Q: Elevation of serum amylase and lipase is commonly seen in: Acid reflux disease, Acute…
A: Acid reflux disease is a common disease where bile juice from gall bladder or Hydrochloric acid from…
Q: C. Practical Application of Osmosis 1. Place a lettuce leaf, a slice of a cucumber and a stalk of…
A: The plant cells have thick and rigid walls that do not shrink or break when water moves in and out…
Q: What is the type of sexual spore (Ascospore or Basidiospore) in: 1. Schizosaccharomyces pombe 2.…
A: Ascospore is a sexual spore produced by fungi ascomycetes. Basidiospore is a sexual spore produced…
Q: 8. A very small, random, non-representative sample a population colonizes a new island. Individuals…
A: This is an example of D. Genetic drift and founder effect
Q: How does touch DNA demonstrate Locard's principle
A: Touch DNA is DNA obtained from biological material transferred from a donor to an object or a person…
Q: Which type of exercise is generally more functional? Group of answer choices Closed linked Open…
A: Introduction: Exercise give strengthen to the heart and improves the circulation, increased…
Q: A laboratorian obtains a Urea N value of 61 mg/dL and a serum creatinine value of 2.5 mg/dL on a…
A: Renal function Renal function or kidney function, it remove waste material from our body in the form…
Q: Gene dosage is important for a number of genetic phenomenon. Name two and explain their relationship…
A: The gene dosage is a concept in which the synthesis and concentration of the primary gene product is…
Q: ATP-->ADP + iP, what is released in this reaction.
A: Introduction : The chemical molecule known as ATP is made up of phosphate groups, adenine, and the…
Q: Both nervous and endocrine systems are important in regulating body mechanisms to maintain…
A: Nervous system and endocrine system both are the systems that are mainly responsible for control and…
Q: Your graphs should have helped you learn about relationship between size and respiration; what is…
A: Respiration The process of respiration takes place in the mitochondria of the cell.
Q: A 67-year-old retired male went to his doctor, complaining initially of leg pain that started in his…
A: Introduction Hormones are a group of signalling molecules found in multicellular organisms that are…
Q: The human Genome project began in 1990’s, and intended to do what? 2. Did the human genome project…
A: Note:- Sorry, please note that as per our company's honor code we are allowed to author only the…
Q: learn.edgenuity.com/player/ SC5181 A Mark this and return < : A lichen is an organism that is…
A: Introduction :- Obligate mutualism is a species-to-species connection in which each are totally…
Q: What is the genetic phenomenon by which, two individuals carrying the same allele causing a disease…
A: The alleles are the alternative forms of a gene that are located on the same locas of a homologous…
Q: Which of the following best describes the principle demonstrated in the figure below? CH.OH H H Н Н…
A: Every living creature goes through a primary mechanism known as metabolism. Metabolism happens…
Q: Forest Nursery Subject (For Forester's) Comment on vegetative structures and wildlings as planting…
A: Introduction Forest Nursery:- It is a place or an area where forest seedlings, plants, trees, and…
Q: Both NADH and FADH2 molecules pass electrons to
A: Cellular respiration is a metabolic process involving a series of three major steps that metabolize…
Q: Apolipoprotein A-1 is the major protein of which lipoprotein? Chylomicrons, VLDL, LDL, or HDL?
A: Introduction :- Apolipoprotein (Apo), a protein found in plasma lipoprotein, has the ability to bind…
Q: Why is control over blood [Ca2+] and [Red Blood Cell] crucial? Choose one hormone involved in either…
A: Nephron is the structural and functional unit of kidney. There are different blood cells such as…
Q: Review the image of the Coleus stem tip, longitudinal section, in Exercise 4.2, then answer the…
A: Primary growth is a conclusion of rapidly-dividing cells in the apical meristems at the shoot tip…
Q: Which of the following enzymes is activated in the stomach to promote digestion of dietary proteins…
A: Lipase helps in the digestion of fats. Amylase digests carbohydrates. Trypsin helps in the digestion…
Q: Question 6 A group of environmental scientists wants to make a plan that will reduce human impacts…
A: In the lower atmosphere, CO2, methane, N2O, and CFCs are the major greenhouse gases those levels are…
Q: D In the following DNA strand, find the position of the start codon, stop codon and determine the…
A: The given DNA strand - GGTACTTTATACCCTGATACATTTGTGGGG Corresponding mRNA strand -…
Q: Would a cell undergo a proper mitosis, if the S phase was skipped during interphase? Explain why yes…
A: Introduction Cell division:- Cell division happens when a parent cell divides into two or more cells…
Q: An amino acids unique property arises through which component? How does this same component…
A: Amino acids are the monomer units that adjoin via peptide linkage to form a long peptide chain that…
Q: describe the yeast specimens grown on PDA using Dalmau Plate Method incubated at 35°C for 48 hours…
A: Potato Dextrose Agar (PDA) is a general purpose medium for yeasts and molds that can be supplemented…
Q: You have a spread plate made with 200ul of a 10^-2 dilution. You counted 112 colonies on the plate.…
A: Microbial culture refers to the method of letting the micro-organisms multiplying in the culture…
Q: Consider the true diploid plant cell (2n=4) below. The paternally derived blue chromosomes are of…
A: Cell division is a phenomenon in which parent cell undergo splitting process and give rise to novel…
Q: { 1. in the diagram of the woody bass- cork can bem 7. zylum Vascular tissue (phloem) Cortex Cork…
A: It is secondary growth in dicot stem in which activity of vascular cambium increase girth of stem.…
Q: D Question 1 In lentic systems, the majority of organic matter comes from allochthonous sources.…
A: Aquatic ecosystem are divided on the basis of whether flowing water (such as river) or still water…
Q: The presence of a narrow band between the Beta and gamma regions on SPE would most likely indicate…
A: Pre-analytical steps, the major source of mistakes in laboratory diagnostics, arise during patient…
Q: ADENOSINE ATPIS Ĵ ADP ( RIBOSE TAKE A TOUR USE ADP RIBOSE POM POM PO PHOSPHATE GROUPS RESPIRATION…
A: We are allowed to do upto three subpart of a question only. Please repost the undone questions…
Q: what are the consequences of pericarditis?
A: The pericardium is the layer(s) surrounding the heart that is made up of connective tissues and it…
Q: In a parental cross of a autosomal dominant homozygous lethal disease trait, where the father is…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: In Drosophila, singed bristles (sn) and cut wings (ct) are both caused by recessive, X-linked…
A: Introduction :- There are two sets of chromosomes in humans. Allele pairings are categorised using…
1. Could u pls discussed about the water pollutants and Summarize the details
2. discussed about air pollutants and Summarize the details
Step by step
Solved in 2 steps
- Explain how the 3Rs (reduce, regulate, restore) of the pollution management strategy resolve the: 1. Smog pollution 2. Acid precipitation58. TOSCA (Toxic Substances Control Act) was signed in 1976 for the purpose of: a Developing an inventory of all commercial chemicals in use b Dictating which waste sites would be considered for Superfund money c Listing all chemical used in the U.S. d Controlling the direct release of toxic chemicals from pipes (point-sources)Name the pollutants which are degradable.
- List International and Philippine laws on environmental pollution. Briefly describe each law. Cite as many as you can.Describe several categories of pollution that are becoming ever more serious problems.S.1. Plant Organics produced gas. S.2. In shallow and moderate temperature hydrocarbon produced was gas. a. Statements 1 and 2 are both correct b. Statement 1 is correct, Statement 2 is wrong c. Statement 1 is wrong, Statement 2 is correct d. Statements 1 and 2 are both wrong
- How is waste water managed in your community? Describe it.What environmental effects do you for see on the air quality and water bodies?What are the causes of poor solid waste management in your communityHow is waste water managed in your community? Describe it.Explain the manner in which pollution is caused by solid industrial waste, industrial effluents and industrial waste gases.
- Give 3 ways of how water pollution can be controlledWhat are the taken actions nowadays to counteract the effect of pollutants in the air? Mention 4 actions.Describe the primary sources and some of the health problems associated with each of the following pollutants: carbon monoxide (CO) sulfur dioxide (SO2) volatile organic compounds (VOCs) nitrogen oxides