Q: functions of, and describe Cerebrum, Cerebellum, Corpus callosum, Pons and Medulla oblongata.
A: Introduction: The brain is a sophisticated organ that manages every bodily function as well as…
Q: How is the correct bacterial symbiont selected in the squid–Aliivibrio symbiosis?
A: Squid rely on Allivibrio bacteria to produce light, which helps them to mix in with light from…
Q: which of these is a/arepossible treatment option(s) for the disease(s) caused by mutations within…
A: A. Surgery - Surgery is a procedure that involves cutting of a patient's tissues or closure of a…
Q: What are some examples of diffusion, osmosis, facilitated diffusion and active transport?
A: The body employs a range of mechanisms to maintain balance, each with its own specific functions and…
Q: Animal fats for saturated fats are liquid at room temperature and include foods like olive oil, fish…
A: 2. Fats are an essential macronutrient that are important for many bodily functions, such as…
Q: Consider three yellow, round peas, labeled A, B, and C. Each was grown into a plant and crossed to a…
A: Introduction A gene exists in two alternative forms called alleles. If both the alleles are same, it…
Q: In a clinical trial it might seem unethical to compare a drug candidate versus a placebo rather than…
A: The term “Placebo” refers to a substance that is manufactured to have no therapeutic value. For…
Q: what does it mean by Genetic and genomic research can have social and environmental implications.…
A: Genetics is the study of genes present in the genomes of an organism. Genomics is associated with a…
Q: Problem #4 One of the genes for coat color in cats is found on the X chromosome. Male cats are…
A: This question is asking about the inheritance of coat color in cats. Specifically, it is asking…
Q: Outgroup Cow Deer Hippo Pig Peccary Camel Whale (b) Outgroup Cow Deer Whale Hippo Pig Peccary Camel…
A: From the given picture of phylogenetic tree, it is clear that pigs, deer, cattle and camels gained…
Q: Explain why seasonal stratification of temperature and oxygen takes place in deep ponds and lakes.
A: The propensity of lakes to generate separate and distinct thermal layers during warm weather is…
Q: Describe an experiment to test whether soil pH affects the growth rate of sunflowers. Include all of…
A: Research can reveal gaps in our knowledge and understanding of plant development, guiding future…
Q: Describe the processes of meiosis and mitosis
A: "Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: 2. Large predatory marine fish (ex: tuna, swordfish, marlin, shark, etc.) usually eat at the third…
A: Large predatory marine fish, such as tuna, swordfish, marlin, and shark, are often considered…
Q: one potential treatment for addiction is to inhibit the expression of the gene that codes for the…
A: Addiction is a complex condition that is characterized by compulsive drug-seeking behavior and drug…
Q: Differentiate between pro-insulin and mature insulin
A: Pancreas is the gland,which releases the hormone insulin.It is basically the beta cells of…
Q: of the stages of an action potential, including a description of and explanation for the refractory…
A: The normal resting membrane potential is about -70 mv. The electric signals produced by the neuronal…
Q: Describe the path and all related steps that a molecule of oxygen would take from the air in the…
A: First of all we know that respiration is a very essential process for our body.Only throgh this…
Q: Transcription start site selection by S. cerevisiae Pol II occurs over a range of positions located…
A: Introduction: Transcription start sites (TSSs) are acquired by RNA polymerase II (Pol II) in…
Q: article: Dolly the sheep 1. Mention 2 failed attempts on mammal cloning. 2. What did you learn…
A: Dolly was "female Finnish Dorset sheep" and is the first mammal cloned by using the process of…
Q: Which of the following is an important model organism for studying development? a. E.coli O b. D.…
A: Model organisms: When the process of development is studied in detail the model organisms…
Q: List what has to happen to pre-mRNA before it is considered mature mRNA
A: Pre-mRNA are formed when RNA transcript is firstly made in eukaryotic cells. This pre-mRNA has to be…
Q: List examples of the synthetic, metabolic, and excretory functions of the kidney
A: Understanding the functioning of the body's systems is essential for several reasons. By…
Q: Problem #1 In some chickens, the gene that produces color shows incomplete dominance. The gene will…
A: Incomplete dominance results from a cross in which each parental contribution is genetically unique…
Q: Which of the following statements about hominins is FALSE? Each hominin species on Earth was…
A: The development of Homo sapiens as a unique species inside the hominid group, that also comprises…
Q: Which of the following techniques would be most appropriate to test the hypothesis that humans and…
A: Natural selection is the process through which populations of living organisms adapt and change.
Q: What is one of the determining factors in the three-dimensional structure of a protein? A.The…
A: Introduction:- There are different types of bio-macromolecules and bio-micromolecules present in…
Q: In this diagram, which of the following is TRUE? H+ (proton) Organic molecule that includes two…
A: Option B ) The NAD+ becomes reduced.
Q: Which of the following is true about antigen presentation, MHC involvement or T cell activation?…
A: Introduction = Major Histocompatibility Complex- Cluster of genes found in all mammalsIts products…
Q: Filarid (microfilaria) parastites in lymphatics would most often cause which of the following…
A: A parasitic condition known as filariasis is brought on by an infection with roundworms of the…
Q: bioreactors
A: In biotechnology, bioreactors are used to guide tissue structure, organization, and ultimately…
Q: What is the independent variable in this experiment? a) Data collected such as the health and growth…
A: Before going through the question to answer it, it is important to understand that what is the term…
Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…
A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…
Q: How do the presence/loss, form, and function of theradula differ within members of the Classes…
A: One significant autapomorphy of Mollusca is the radula, which is the organ for mechanically…
Q: Please draw the pre-mRNA that would be produced from this gene.Gray nucleotides indicate noncoding…
A: In transcription, the template strand is the strand of DNA that serves as the template for the…
Q: 5. Which of the following is considered acellular? Aspergillus fumigatus Mycobacterium tuberculosis…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Color blindness is a recessive trait on the X chromosome. What are the genotype and phenotype ratios…
A:
Q: What are meninges? Discuss each meninge layer that covers the brain
A: Introduction: The brain and spinal cord make up the central nervous system. The brain directs our…
Q: Which of the following is NOT true about chemoheterotrophs? They are ultimately dependent on…
A: Chemoheterotrophs are the organisms, that depends on other organism for both energy and carbon. In…
Q: RNA: Using the two ribonucleotides you chose, draw the two monomers bound together into a compound,…
A: Introduction - RNA is a polymer composed of RNA Nucleotides.Each "Nucleotide" is made up of 3…
Q: MAKE A DECISION: Which approach would you recommend to Catarina during her pregnancy? Catarina…
A: Pregnancy is the state of being pregnant or having a fertilized egg implanted in the womb, which…
Q: NH₂ 1 N= CH: A B C C-N 3-4 HC HICI I OH B HICIO с OH E HICIH -21 High-energy bonds 044 P-O G O-P-O-…
A: ATP stands for Adenosine triphosphate.It is the energy currency of the cell.It is considered as…
Q: Suppose a 10-year old patient has come to your office with a very rare disease. One so rare that…
A: Rare diseases - Diseases which affects very small percentage of population. Gene sequencing - It is…
Q: 3. Using this chart as support, explain why most plants, algae, and photosynthetic bacteria appear…
A: ANSWER) Photosynthesis is the process by which the plants, cyanobacteria and algae use the carbon…
Q: shirt (Sample A, n=83, Sample B, n = 19). Women at high conception risk were substantially more…
A: First let's try to understand these terms clearly:
Q: What are the major benefits and the disadvantages of a rumen system? How does a cecal animal compare…
A: Rumen system is the ruminant digestive system. Ruminants are those who eat plants- herbivorous…
Q: 4. As an object moves farther away from the eye, how does the lens change to keep the object in…
A: ANSWER) The human has the ability to accomodate the curvature in order to alter the focal length to…
Q: Compare and contrast diabetes mellitus and diabetes insipidus.
A: Diabetes is a chronic disease that lasts for a long period of time and is typically characterized by…
Q: give inherent constraints associated with the biology of the of zebra fish and quail or chicken eggs…
A: Developmental biology is the study of the process by which organisms grow and develop, beginning…
Q: Which of the following is true about MHC? Check all that apply. A. MHC I is expressed in all…
A: Major Histocompatibility Complex(MHC) is basically a group of genes on DNA.It mainly helps the…
Step by step
Solved in 2 steps
- Describe the function of the following reagents used in the DNA extraction procedure?a) Proteinase K b) 5M Nacl c) Isopropanol d) 1X TE BufferWhen Avery, MacLeod and McCarty used the enzyme __________. No bacterial transformation took place indicating that the biochemical nature of Griffith’stransforming factor is very probably ______. a)protease,protein b)DNase, DNA c)RNase, RNA d)lysozyme,components of the cell wall.Which of the following enzyme:function pairs is/are correct? a.primase:forms RNA primer b.ligase:join Okazaki fragments c.gyrase:relax supercoils d.DNA POI ll:removes RNA primers
- In ion torrent DNA sequencing, covalent bond formation is detected by an ion sensor sensitive to protons. What is the source of the protons?Which component of DNA imparts a negative charge to the molecule? asap please detail explanationThe formation of deoxyribonucleotide from ribonucleotide requires all the following except: a.Nucleoside diphosphate (NDP) b. Nucleoside triphosphate (NTP) c.Thioredoxin d. Ribonucleotide reductase
- Define the following terms:a. enzyme inductionb. covalent modificationc. nucleotidylationd. allosteric sitee. compartmentationIn primer designing, which of the following statements is correct? a. Primers should be 18-24 bases in length. b. Base composition should be 45-55% (G+C). c. Melting temperatures between 55-70°C are preferred. d. All choices are correct.In the early 1940s, Oswald Avery and his team set out to identify the conditions necessary for Griffith's transformation to take place and set out to determine which factor was responsible for the transformation. Which macromolecule did they conclude was responsible for transformation? a RNA b protein c carbohydrate d nucleic acid
- Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’Draw the schematic diagram of the protein purification through hydrophobic column chromatography and explain the purpose of each step.The hydrolysis of nucleoside triphosphates A. is required for them to act as regulatory molecules. B. is needed for their function as coenzymes. C. allows for hydrogen bonding of double-stranded DNA. D. provides the chemical energy needed for some biochemical reactions.