1) create food.txt with the following contents turkey 20.80 pie 7.4 stuffing 2.68 2) read the values from file.txt in a function using references parameters [Note: You must write a function and you must use reference parameters] 3) Print the cost for each item and total cost [Note: Your costs should be in the following format dollar sign dollars sents and show 2 decimal points]

1) create food.txt with the following contents turkey 20.80 pie 7.4 stuffing 2.68 2) read the values from file.txt in a function using references parameters [Note: You must write a function and you must use reference parameters] 3) Print the cost for each item and total cost [Note: Your costs should be in the following format dollar sign dollars sents and show 2 decimal points]

Name: C++ must attach ouput and code screen shot and editable code also do
Uploaded: 2024-03-20T06:51:23.000Z
Channel: Bartleby
Description: C++ must attach ouput and code screen shot and editable code also do add commentsanswer correctly else downvote 1) create food.txt with the following contentsturkey 20.80pie 7.4stuffing 2.682) read the values from file.txt in a function using refere

C++ Programming: From Problem Analysis to Program Design

8th Edition

ISBN:9781337102087

Author:D. S. Malik

Publisher:D. S. Malik

Chapter13: Overloading And Templates

Section: Chapter Questions

Problem 22SA

See similar textbooks

Similar questions

Create a new file in c++ and save it as lab11_XYZ.cpp (replace XYZ with your initials). Create ANOTHER new file (in C++) and save it as swap_XYZ.h (replace XYZ with your initials). Use the swap_XYZ.h header file to define a set of functions for swapping two items of the same type. Given the following prototypes, define (overloaded) swap functions void swap(int&, int&); //swap two integers void swap(double&, double&); //swap two doubles void swap(float&, float&); //swap two floats void swap(char&, char&); //swap two characters void swap(string&, string&); //swap two strings The header file should contain the following: header comments (similar to normal program header comments) function prototypes (provided above) function definitions (for you to do...) In general, a swap works like this: void swap(type first&, type second&){ type temp = first; first = second; second = temp; } Once your header file (H file) is complete, make…
c++ Please Dont use Chegg for this problem 15.7 In-Lab Activity 7: Shapes (I/O operator overloading) In this program, you must implement I/O operator overloading (<< and >>) to match a shape's functionality. You must modify the following files: Triangle.h Implement the declaration for the overloaded I/O operator functions. Triangle.cpp Implement the calculateArea() function to find the area of the triangle. Implement the definitions for the overloaded I/O operator functions. The input function will take in two variables: The base and height (cin >> base >> height) Call the object's calculateArea() function after inputting the variables. The output function will send the following to the output stream (for base = 10 and height = 20): Triangle Object: Base: 10 Height: 20 Area is: 100 Square.h Implement the declaration for the overloaded I/O operator functions. Square.cpp Implement the calculateArea() function to find the area of the square. Implement…
Write a void function that will merge the contents of two text files containing the chemical elements into a single binary file. The function's parameters will be three file pointers; each text file will contain an integer atomic number followed by the element name, chemical symbol and atomic weight. Here are two sample lines: 11 Sodium Na 22.9920 Calcium Ca 40.08 The function can assume that one file does not two copies of the same elements and that the binary output file should have the same property. IN C PLEASE
Use C++ I need three files, one main.cpp file, one rational.cpp file and one rational.h file. I'll put the code for the main.cpp file and rational.h file below. No need to change them I just need the rational.cpp file. Modify the code to have operator overloading functions with the following operators.==, <, <=, >, >=, +, -, *, /Use the Rational interface and main code in the next page. main.cpp: #include <iostream>#include "rational.h"int main(){ Rational r1, r2; char answer = 'y'; while (answer == 'y') { cout << "Enter the first fraction (e.g. 3/4) : "; cin >> r1; cout << "Enter the second fraction (e.g. 3/4) : "; cin >> r2; cout << "r1 : " << r1 << endl; cout << "r2 : " << r2 << endl << endl; cout << "r1 + r2 = " << r1 + r2 << endl; cout << "r1 - r2 = " << r1 - r2 << endl; cout << "r1 * r2 = "…
In this final submission, you will build on checkpoint B to load the database and DNA sequence from files. There will be two databases and several sequences that will be available for download below. Example of the database is the file small.txt: name,AGATC,AATG,TATC Alice,2,8,3 Bob,4,1,5 Charlie,3,2,5 Example of the sequence is the file 1.txt: AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG Implement/modify the following functions: Modify the function readData, which will now take an additional parameter: a string representing the filename containing the database of individuals and their STR counts. It will also return a bool indicating if opening the file was successful or not: bool readData(string filename, vector<string>& nameSTRs, vector<string>& nameIndividuals, vector<vector<int>>& STRcounts) Update the function…
Pointers are by default passed by value in a function. Group of answer choices True False ================= Given the below code segment, which of the following would allow you to deallocate all memory allocated to the pointer numbers? int* numbers = new int[5]; Group of answer choices delete[] numbers; delete numbers; delete[5] numbers; None of these ========== Consider the following code: int arr[][4] = { {1, 2, 3, 4}, {7, 8, 9, 10} }; cout << arr[1] << endl; What will be the output? Group of answer choices 1 7 Address of 1 Address of 7 Compilation error: Second [] bracket missing with arr
Implement the following functions. Each function deals with null terminated C-Style strings. You can assume that any char array passed into the functions will contain null terminated data. Place all of the functions in a single file and then (in the same file) create a main() function that tests the functions thoroughly. You will lose points if you don't show enough examples to convince me that your function works in all cases. Please note the following: You may not use any variables of type string. This means that you should not #include <string>. Also, you may not use any c-string functions other than strlen(). If you use any other c-string functions, you will not get credit. Note, however, that functions such as toupper(), tolower(), isalpha(), isspace(), and swap() are NOT c-string functions, so you can use them. Also note that this prohibition is only for the functions that you are assigned to write. You can use whatever you want in your main() function that tests the…
Implement the following functions. Each function deals with null terminated C-Style strings. You can assume that any char array passed into the functions will contain null terminated data. Place all of the functions in a single file and then (in the same file) create a main() function that tests the functions thoroughly. You will lose points if you don't show enough examples to convince me that your function works in all cases. Please note the following: You may not use any variables of type string. This means that you should not #include <string>. Also, you may not use any c-string functions other than strlen(). If you use any other c-string functions, you will not get credit. Note, however, that functions such as toupper(), tolower(), isalpha(), isspace(), and swap() are NOT c-string functions, so you can use them. Also note that this prohibition is only for the functions that you are assigned to write. You can use whatever you want in your main() function that tests the…
1. Inspect the code and in your own interpretation, describe the reason call to functionChangeIt_1(n) will not change x in main()? 2. Inspect the code and in your own interpretation, describe the reason parameter n inChangeIt_2(int *n) is a pointer, and statement in the function is *n = 6 ? 3. Write a function called void swap with two parameters, which will receive the addressof x and y as pointer. The function should swap the value of x and y only if x is larger thany. Print the value of x and y after the function call. 4. Write a function called double getAverage(int *array, int SIZE), whereit accept the array as pointer, and return the average of the array. Print the returnedvalue from this function. Always use *array rather than subscript to access the arrayvalue.
Instructions: 1. Submission deadline6/1/20232. If you copy from others zero will be given. 3. Assignment should be written with neat handwriting on proper A4 papers. 4. Upload the handwritten assignment in the blackboard, and submit the written Assignment physically. Q1) Consider the following code: intn=10, m:m=2⋅(n+m)What is the values ofmandn? Answer: Q2) Determine the error and rewrite the correct code for the following function declaration; char Total(intx,y, intz) \{ ints=x+y+z; returns; Answer: Q3) Exercise: Write a function that take your name and print a message say: Welcome, your name. Answer: Q4) Consider the following statements: struct studentName string first; string last; i; int main0 studentName st1, st2; Mark the following statements as valid or invalid. If a statement is invalid, explain why. a. st1.first="William"; b. st 1.last="Smith"; c. cin≫>st2; d. coutC++code to store the first component of products as follows: partName :printer, price : 150 c. Write…
1 - Nuclear Power Plant (python) The nuclear powerplant at Threeyedfish will automatically run a program to print a warning message when the reactor core becomes unstable. The warning message reads: NUCLEAR CORE UNSTABLE!!! Quarantine is in effect. Surrounding hamlets will be evacuated. Anti-radiationsuits and iodine pills are mandatory. Since the message contains crucial information, it should be printed three times. To do this, write a function that prints this message. This function has to be used three times.
You are required to make changes in the below programs and introduce the use of compaction where required. FIRST-FIT #include<stdio.h> #include<conio.h> #define max 25 void main() { int frag[max],b[max],f[max],i,j,nb,nf,temp; static int bf[max],ff[max]; clrscr(); printf("\n\tMemory Management Scheme - First Fit"); printf("\nEnter the number of blocks:"); scanf("%d",&nb); printf("Enter the number of files:"); scanf("%d",&nf); printf("\nEnter the size of the blocks:-\n");for(i=1;i<=nb;i++) { printf("Block %d:",i); scanf("%d",&b[i]); } printf("Enter the size of the files :-\n");for(i=1;i<=nf;i++) { printf("File %d:",i); scanf("%d",&f[i]); } for(i=1;i<=nf;i++) { for(j=1;j<=nb;j++) { if(bf[j]!=1) { temp=b[j]-f[i]; if(temp>=0) { ff[i]=j; break; } } } frag[i]=temp; bf[ff[i]]=1; } printf("\nFile_no:\tFile_size :\tBlock_no:\tBlock_size:\tFragement"); for(i=1;i<=nf;i++) printf("\n%d\t\t%d\t\t%d\t\t%d\t\t%d",i,f[i],ff[i],b[ff[i]],frag[i]); getch(); }