1. In a nutrient broth, where do microorganisms acquire their requirements for mineral elements like Ca, Fe, from? 2. During sterilization, pH of culture media may change. How can this be fixed? 3. How does pH affect the shelf life of unsterilized media?
Q: What is photoinhibition and how does this concept involve the PSII reaction center protein D1 and…
A: PS II stands for Photosystem II, which is a large protein complex that is involved in the…
Q: Experiencing goose flesh is a physiological condition that is generally associated with the emotion…
A: A physiological condition refers to a state or condition of the body that is related to the normal…
Q: A diagram displaying the different levels of organisation of the nervous system
A: The nervous system is a complex network of cells and tissues that work together to transmit signals…
Q: Place the following events in order of which would occur first to last: First Second Third Fourth…
A: Reproduction is the biological process by which new individuals of the same species are produced. It…
Q: 3) What is meant by the terms "delta variant" and "omicron BA.2" variants? How many waves of global…
A: The delta variant and omicron BA.2 variant are two strains of the SARS-CoV-2 virus, which causes…
Q: The most commonly found phenotype in the natural population of a species is called the?
A: Phenotype refers to the physical and observable characteristics of an organism that are determined…
Q: Criminals will be scared away by the scan of your face that a facial recognition system does?
A: Face recognition technologies are getting increasingly common in society, with employment in…
Q: What variables should be controlled (kept constant during the lab procedure)? (more than one choice…
A: In order to provide precise and trustworthy findings during a lab operation, controlling factors is…
Q: draw a diagram of the negative and positive feedback regulations of the thyroid hormones.
A: A gland is a structure which is similar but smaller than organ . It play important role in…
Q: In the morning, urine tends to be concentrated because _______ secretion of ADH _______. Group of…
A: ADH stands for Antidiuretic Hormone, which is also known as Vasopressin. It is a hormone produced by…
Q: 7. Differential (Alternative) RNA processing A. Cu vs Cô (IgM vs IgD) B. Membranous Ig vs Secretory…
A: Immunoglobulin, also known as an antibody, is a protein molecule produced by plasma cells in…
Q: Answer by listing only the name of the disease. Some questions will require the name of the…
A: Answers of the above questions are provided below in step 2
Q: 2. Describe or draw the most suitable immunological assays or experiments for the following…
A: Designing suitable immunological assays for different scenarios can be critical for the timely and…
Q: Scenario C: Your Uncle raises beef cattle and is considering adding low amounts of antibiotics to…
A: A family of medications known as antibiotics is used to treat bacterial infections. They function by…
Q: 8.What is the difference between circadian rhythms and photoperiodism?
A: Both circadian rhythms and photoperiodism have ramifications for how animals react biologically to…
Q: Which pair of restriction enzymes will you use to insert EGFP gene from Addgene Vector 174028 in…
A: Restriction enzymes, also known as restriction endonucleases are enzymes that recognize and cut DNA…
Q: a) 5'-ATGGGCTCGCACTCATAA-3' b) 5'-ATGGTCTCGAACTCATAA-3' c) 5'-ATGGGCTCGAACTCATAA-3'…
A: The original coding sequence of the gene is: 5'-ATGGGCTCGAACTCATAA-3' Using the genetic code and the…
Q: Give typing answer with explanation and conclusion Dose-response relationship between number of…
A: A dose-response relationship is the relationship between the amount or dose of a substance,…
Q: Regulating blood glucose levels is important. When the concentration of glucose in the blood is too…
A: Insulin and glucagon are two crucial substances that play a role in controlling the body's blood…
Q: How would you go about cloning this amplified DNA into pL4440？Using your knowledge of cloning…
A: Cloning is the process of creating genetically identical copies of a biological entity, such as a…
Q: looking at the blood count (White blood cell, heamoglobin value and platelet value of this patient)…
A: A cancerous condition called acute lymphoblastic leukaemia (ALL) affects the bone marrow and blood.…
Q: What is complementary base pairing? A. The DNA molecule copies itself to a complementary RNA…
A: DNA is a double-stranded molecule that contains the genetic code for an organism. It consists of…
Q: Tiktaalik is an extremely important Water to Land Transition animal because it is the exact…
A: Water to land transition animals, also known as tetrapodomorphs, are a group of organisms that…
Q: These answers were wrong on the test
A: Individuals with sickle cell anemia have a genetic mutation in their hemoglobin gene that leads to…
Q: When it comes to controlling microbial growth in microbiology lab, why is autoclaving so vital? What…
A: Microbial growth refers to the increase in the number of microorganisms such as bacteria, fungi,…
Q: Give typing answer with explanation and conclusion 1) A population of HIV viruses exposed to any…
A: The immune system, which is in charge of warding off illnesses and pathogens in the body, is…
Q: What happens to somatostatin levels after a meal?
A: Somatostatin is a peptide hormone that is produced by specialized cells called delta cells, which…
Q: 1-Recent testing has determined that Kate Middleton (the wife of Prince William) is a carrier for…
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: You are a commercial developer, and you were asked to develop a golf course on what is presently…
A: Water quality refers to the chemical, physical and biological characteristics of water that…
Q: Give a brief overview of the role leptin might have on puberty.
A: Leptin is a hormone produced by adipose (fat) cells that plays a crucial role in regulating appetite…
Q: 0. Class switching (Chapter 11)
A: Mutation is a process that occurs when there is a change in the genetic material (DNA) of an…
Q: Copepods contain about 68 μg of C, if they have a grazing rate of 0.38 d-1, how much carbon per day…
A: This question is about how Copepods eat. Copepods are small crustaceans in the water that are…
Q: 20 Skipped The Multiple Choice O оо is the brain structure most involved in perceiving interoception…
A: Interoception refers to the perception of internal bodily sensations such as heartbeat, respiration,…
Q: 1-Gigantism is being traced in a family through a pedigree. Its mode of inheritance is thought to be…
A: In autosomal recessive inheritance pattern both males and females are equally affected. The mutation…
Q: Which of the following statement is correct regrading recombination frequency map units? Two genes…
A: Recombination frequency is the probability that two genes located on the same chromosome will be…
Q: Translate the following mRNA transcript 5’CGCCGAUGCGCGAUAUGUGGUAA’3 A. RRCAICG B. ADARYVV C.…
A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…
Q: Describe the concept of a stress activated signaling pathway using an example from the lectures.…
A: A stress-activated signaling pathway is a cellular mechanism that is activated in response to…
Q: 6) The host (human) protein that serves as the virus receptor is: The normal function of this human…
A: Coronavirus: The coronavirus, also called the SARS CoV -2 virus, is responsible for causing the…
Q: In January, the turtle is likely to have cryoprotectant in the extracellular space. Question…
A: Thermoregulation is a survival biological mechanism performed by mammals to regulate the body…
Q: Description Label the parts of the kidney seen above.
A: A kidney is a vital organ in the body that is responsible for filtering waste products from the…
Q: write a paragraph on why short acting bronchodilators, nebulizer/ inhaler or volumatic/chambers are…
A: Spirometry is a common lung function test that measures the amount of air a person can inhale and…
Q: What happens to leptin levels during pregnancy? Suggest why this may occur.
A: Pregnancy-induced changes in hormone levels that may influence central leptin sensitivity - ↑…
Q: Name the layer of the mucosa(tip of arrow).
A: Mucosa or the mucosal membrane is the softest tissue lining the lines of the internal organs and…
Q: Mention the symptoms presented by cows with a limp.
A: Limping is an abnormal gait pattern characterized by difficulty or pain when walking, which causes…
Q: Giovani Aldini's reanimation experiments, especially in humans, were actually aimed at achieving…
A: Giovanni Aldini was an Italian physicist and anatomist who conducted reanimation experiments in the…
Q: 1. We observe the trait of face freckles (F/f) within a population of 800 people in Mesa. For this…
A: The Hardy-Weinberg Law also known as the Hardy-Weinberg equilibrium, principle or model is a…
Q: 4) What are the defining chemical features of the coronavirus? Is this an enveloped or non-enveloped…
A: Coronavirus is a family of viruses that can cause respiratory illnesses ranging from the common cold…
Q: 4. Mechanism of V/J or V/D/J joining Signal Sequences (RSS): two types for recognition/pairing. A.…
A: B cells and T cells are two types of white blood cells that play crucial roles in the immune system.…
Q: The following phenotypic change of a bacterium is possible by transfer of DNA by "'conjugation". A)…
A: Toxins are substances produced by microorganisms including bacteria that can cause harm or disease…
Q: List and explain four loop holes as of March 2020, that do not require the USDA to regulate gene…
A: A gene-edited plant is a plant that has been modified using modern genetic engineering techniques…
1. In a nutrient broth, where do microorganisms acquire their requirements for mineral elements like Ca, Fe, from?
2. During sterilization, pH of culture media may change. How can this be fixed?
3. How does pH affect the shelf life of unsterilized media?
Step by step
Solved in 3 steps
- 5. Soil X’s pH is measured before and after urea application, it has been noted that after the application of urea, pH decrease, which of the following processes is most likely responsible for the decrease in soil pH? A. Nitrogen fixation B. Annamox C. Nitrification D. Denitrification1.) During a laboratory activity, Chemical reactions from mixture of chemicals should be observed under which laboratory equipment? a.) autoclave b.) fume hood c.) Labaratory Safety cabinet d.) Centrifuge 2.) Which type of equipment contains a HEPA filter that only removes suspended materials from exhausted air? a.) Fume hood b.) Biosafety Cabinet I c.) Biosafety Cabinet II d.) Biosafety Cabinet III1. Why is it the Fluidized Bed Bioreactor is important in the biological wastewater treatment compare to other bioreactors?
- Explain the reasons why the Poon Choi is the high risk food for the elderly? It would be easily spoiled if you found the condensed water on the inner side of the cover lid of the container, and also if you put it at room temperature for more than two hours. Explain in term of the factors of microbes growth. Explain it in detailed.In a nutrient broth, where do microorganisms acquire their requirements for mineral elements like Ca, Fe, etc. from? Can gelatin be used in culture media preparation? How is it different from agar? During sterilization, pH of culture media may change. How can this be fixed? How does pH affect the shelf life of unsterilized media?Microorganisms are often grouped according to their optimum growth temperatures. Which groups are most likely to spoil refrigerated foods?
- 1. The Petri Dish method is used in microbiology to raise bacteria in: a) rapid growth b) pure culture c) septic environment d) all of the above 2. What is the difference between antiseptic and sanitization? 3. In order to prevent any kind of contamination the medium must be _________ before placing it in the Petri dish. a) lyophilized b) pasteurized c) autoclaved d) distilledAnswer the following questions: 1. Why is buffering important when preparing a growth media? 2. Explain why bacterial fermentation preserves food from spoilage.An acidophile would grow best at a pH of: A.6 b.2 c.12 d.7 e 9
- 1. How will pH and aw will affect the growth of spoilage microorganisms on food? 2.How will temperature effect the growth of spoilage micrograms on food?8. A retort pouch is: a) Filled first with food product and then retorted (heat-sterilization) to extend product shelf life. b) Food is heat-sterilized first, and then added to a pouch under nitrogen c) Retort pouches requires thermally stable seals d) Both a and c1. Define Optimum Temperature. 2. Why is the temperature of pasteurization at 60°C? 3. Why are food frozen at a temperature below 0°C?