1. You are observing an unknown vertebrate whose limbs are probably vestigial. What are the possible mechanisms of locomotion that this or ganism can have? In relation to vour nrevious suurvey. tetranod Limbe vou gre also giming to look at their origine What
Q: 1. Reagent use to stop mitosis in metaphase? a. Phytohemaglutinin b. Colcemid c. Both d. None 2. How…
A: 1) Ans- D) None Explanation Demecolcine is used as reagent for stop mitosis in metaphases. During…
Q: Arthropod muscle fibers typically do not generate actionpotentials. Using your knowledge of their…
A: Introduction :- Most arthropods move by using their segmental appendages, and the exoskeleton and…
Q: What is gene targeting? Give some examples of gene targeting?
A: Gene is a stretch of DNA in a chromosome which codes for a functional product either in the form of…
Q: make a diagram illustrating the evolution of a domesticated crop (preferably one that is cultivated…
A: Crops has been cultivated from ancient time. Corn is one of the major cultivated crop in different…
Q: Phenylketonuria (PKU) is a disorder caused by a recessive allele. Two carrier individuals have…
A: Answer
Q: Which microevolutionary force typically changes genotype frequencies without changing allele…
A: The allele frequency shows the incidence of an allele or a gene variant in a population. Genotype…
Q: The genetic description of an individual is its genotype, whereas the genetic description of a…
A: Introduction Genetics is the study of genes and heredity, or how specific attributes or traits are…
Q: Which microbiology test measures the use of LACTOSE? What color is positive in each?
A: Lactose is a naturally occurring sugar present in dairy products such as butter and desserts.…
Q: A human disease example in which a dominant allele that is lethal in homozygous state is…
A: Solution Huntingon's disease is a non- sex linked dominant genetic trait which means males and…
Q: Yeast fermentation is of a value in making baked products due to the release of:
A:
Q: Combining your knowledge of rates of diffusion with yourknowledge of muscle physiology, explain why…
A: Slow-twitch (Type I) fibres, which are characterised by muscles with lengthy contraction duration…
Q: How does the concept of a stem cell differ between animal and plant systems?
A: A major difference that lies between plant stem cells as well as animal stem cells is that: plant…
Q: In a population at genetic equilibrium, the frequency of the dominant phenotype is 0.96. What are…
A: Introduction :- The condition of an allele or genotype in a gene pool (such as a population) in…
Q: Why do organisms with close biochemical similarities show stronger evolutionary relationships? *…
A: The answer is (c)they have the common ancestors and have the same kind of proteins.
Q: Ku proteins involve. nucleotide excision repair DNA repair before S phase single DNA strand break…
A: The Ku proteins bind to the ends of the linear phage DNA and stimulate LigD to ligate the ends to…
Q: List two ways you think would minimise or avoid lag phase of microbial growth
A: During lag stage, the bacteria can adjust to development conditions. It is the period where the…
Q: Describe a synaptic mechanism underlying the formation of memory.
A: Synaptic transmission allows neurons to interact with any type of cell that expresses receptors for…
Q: Post-transcriptional modifications in eukaryotic RNAS A. addition of CCA at the 5'end of the TRNA…
A: Answer :- Option (D) is correct. - Addition of CCA at the 5'end of the tRNA for binding with amino…
Q: Discuss the process of eukaryotic transcription in details please.
A: Transcription is a process in which RNA is synthesized from the template strand of DNA. Like any…
Q: How does cytokinesis differ in animals and plant cells?
A: The final stage in cell division in which the cytoplasm divides at the region between two newly…
Q: When you change your focus from near to a far object, describe the three main mechanisms occur in…
A: Introduction :- The human eye is a sense organ that responds to light to allow vision. Both the…
Q: Vhich of the following are required to set up a CRISPR-Cas9 experiment to fix a mutation in a gene…
A: CRISPR or Clustered regularly interspaced short palindromic repeats is a gene editing technique in…
Q: Food is a limiting factor for plants. A. TRUE B. FALSE
A: Living organisms can be classified into two types based on their mode of nutrition. 1. Autotrophs…
Q: Choose correct option and explain shortly. Question:- Which of the following is the best…
A: Flow cytometry is a laser-based technology for detecting and analyzing chemical and physical…
Q: Which complement chemotactic component has properties? а. Cla с. C4a d. C5a b. C2a е. Сба
A:
Q: We do CBC to detect Heart diseases Infection Bone marrow disorder Glucose level Blood pressure…
A:
Q: Here you see the gel electrophoresis of PCR reactions of the pMCT118 VNTR locus of 4 individuals…
A: Answer pMCT118 VNTR locus has multiple repeats that can be analyzed by Polymerase chain reaction…
Q: Only get 10% of energy transfers from one level to the next. Where does the energy go??
A: A graphical representation of the energy found within the trophic levels of an ecosystem is an…
Q: In your practice, you have a patient at increased risk for cardiovascular disease. The statins you…
A: Statins work by competitively inhibiting the active site of HMG-CoA reductase, the first and most…
Q: What is RNA sequencing ?
A: Most living organisms that are well-staed to define as they have DNA as their genetic material. It…
Q: Besides the size and position of the centromere, what is the same about these?
A: *Chromosomes are thread like structures located inside nucleus which is made of protein and a…
Q: 1. Compare and contrast the following systems in the squid, perch, earthworm, and frog. a. Digestive…
A: Digestive system *Squid takes food through their mouth without teeth but their hard beak helps to…
Q: When is a tetrad specifically formed? Would it be found in a haploid or diploid cell? What event…
A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading…
Q: What is the significance of the fact that couples who cannot taste PTC never have children who can?…
A: 1. couples who cannot taste PTC never have children who can taste PTC because when we cross between…
Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…
A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…
Q: In the case of GPCR (G protein coupled receptor) signaling pathways, which of the following…
A: G protein-coupled receptors (GPCR) are cell surface receptors. They are also known as…
Q: Question 2 Which of the following is not a key step in the activation of MRNA synthesis in…
A: The nucleus uses the nucleotide sequence of DNA as a template to synthesize mRNA. The enzyme RNA…
Q: Which of the following is true of TATA boxes
A: Transcription is the process of synthesis of RNA using DNA as a template. The process uses DNA…
Q: Given the challenges of human population, climate change, pollution and poverty. How would you…
A: The primary difficulties to economical advancement which are worldwide in character incorporate…
Q: Question 8 Why does each cell need DNA? O DNA is used by cells for cell transport DNA determines the…
A: Introduction DNA contains the instructions needed for an organism to develop, survive and reproduce,…
Q: G and g are dominant and recessive alleles respectively, for a gene. If a mating of a gg female with…
A: As given in the question that G is dominant allele and g is recessive allele.
Q: Identify the benefits and risks of Genetically Modified Organisms
A: Genetical Modified Organisms in Plants Genetical modified plants is nothing but modifying the DNA of…
Q: What can you do with a closed ecosystem in a container's habitat to create more biotic niches?
A: The ecosystem is made up of biotic and abiotic variables and interactions between these two factors…
Q: Describe briefly the generation of the active form of the transcription factor NFAT. Include the…
A: Nuclear factor of activated T cells (NFAT) was first identified as a Ca 2+/calcineurin-regulated…
Q: why are apples green red and yellow
A: Introduction :- Apple (Malus domestica), one of the most widely grown tree fruits, is the fruit of…
Q: If P stands for purple flowers and p stands for white flowers. Y stands for Yellow pea and y stands…
A: An alternate form of a gene is called alleles. The dominant allele is represented by capital letters…
Q: Replication of DNA requires a primer to initiate DNA synthesis because DNA polymerase can add new…
A: DNA replication is the process by which new DNA is produced from the old DNA in the…
Q: To collect blood from infant patient and you need low ? amount, Which source is good * Arterial…
A: The human body is made various organ system. All these organ systems perform different physiological…
Q: process of eukaryotic transcription in detail and mention the specific enzyme
A: Transcription can be defined as the process of copying genetic information from one strand of the…
w5 apply 2 and 3
Step by step
Solved in 2 steps
- There is current controversy about which group is sister to the rest of the animals. Which two of the following groups are the potential sister groups to all the other animals? a. Ctenophores b. Cnidarians c. Porifera d. Both a. and b. e. Both a. and c.1) Which statement about lungs and gas bladders is true? A) the first osteichthyans had lungs and these lungs were later converted to gas bladders in actinopterygians B) the first osteichthyans had gas bladders and these gas bladders were later converted to lungs in sarcopterygians C) after the two lineages branched apart, actinopterygians evolved gas bladder and sarcopterygians evolved lungs" 2) Why are sharks reliant on ram ventilation unable to breath while remaining in place like other fish do?In your own words: In which ways does the limb orientation of "advanced" tetrapods differ from that of "primitive" tetrapods? What variations have the manus undergone in the evolution of flight (birds, bats, & pterosaurs), swimming, running, & grasping?
- An important evolutionary innovation and a major difference between the limbs of extant lobe-finned fish and extant tetrapods is: Select one: 1. The presence of lobes on the fish fins. 2. Retention of fin rays in tetrapod limbs. 3. Limbs of tetrapods have associated muscles. 4. Limbs are supported by a single basal bone in tetrapods 5. Attachment of the pelvic limbs to the vertebral column via the pelvis in tetrapods. Please explain in detail the correct options as well as the incorrect options.Test Your Understanding 1.Which of the following is not a shared derived character of echinoderms? (a) water vascular system (b) notochord (c) tube feet (d) pentaradial symmetry in adult (e) endoskeleton of calcium carbonate plates and spinesTrilobites (a) were early mollusks (b) are onychophorans (c) are characterized by parapodia and setae (d) were early arthropods (e) are an evolutionary link between annelids and arthropods
- Very few fossils of Sahelanthropus have been found up until now, therefore we do not have a complete image of what its full skeletal anatomy might have looked like. What additional evidence would we need to find in order to better understand the locomotion of this species?Which of the following statements about bilaterian animals is false? A. Many bilaterians are invertebrates but some are not. B. All bilaterians are triploblastic (have three germ layers). C. All bilaterians have bilateral symmetry. D. Most bilaterians have tissues but some do not.Which of the following is NOT a characteristic of the exoskeleton of an arthropod? A. Always laden with calcium salts. B. Chitinized with an outer layer of cuticle. C. The plates are connected with an articular membrane. D. Composed of the tergum, sternum and pleura plates.
- 1. a) List 5 distinguishing factors of reptiles and their similar characteristics to birds. b) How can you establish the evolutionary relationship between reptiles and birds? c) Amniotes are divided into three groups based on their skull morphologies. What are these three groups, and how do their skulls differ? Which living amniotes have originated from each of these three groups? 2. Fill in the table below. Compare the different orders within each class.1. Both Lepidoptera and Diptera have proboscis. true/false. 2. Phthirapterans have large claws that allow them to grab hairs of mammals and birds. true/false 3. Coronal and frontal sutures can be split when molting. true/false 4. Collembola has a pair of furcula. true/false1.The Order Squamata consists of 3 sub orders.Why are these Suborders so different-give at least 2 distinctive characteristics of each. 2.Why are Tuataras not grouped together with lizards?what is the morphological character that separates them? 3.How the reptile eggs differ from amphibian eggs?Why is this important?