16. If the aerobic catabolism of 1 mol of glucose yields 38 mol of ATP, and the energy released byaerobic ATP hydrolysis to ADP is -46 kJ/mol, how much energy is available from 1 mol ofglucose via aerobic catabolism?17. A particular 70-kg man has a basal metabolic rate (BMR) of 7000 kJ/day. A large mouseweighing 30 g has a BMR of about 20 kJ/day. In each case, what is the BMR expressed per kg ofbody mass?18. The allometric equation is BMR = aWb. For mammals, the value of a is approximately 293kJ/day and the value of b is 0.75. What is the predicted BMR for a blue whale of 100,000 kg?

"Since you have asked multiple questions, we will solve the first question for you. If you want a…

16. If the aerobic catabolism of 1 mol of glucose yields 38 mol of ATP, and the energy released by aerobic ATP hydrolysis to ADP is -46 kJ/mol, how much energy is available from 1 mol of glucose via aerobic catabolism?

16. If the aerobic catabolism of 1 mol of glucose yields 38 mol of ATP, and the energy released by aerobic ATP hydrolysis to ADP is -46 kJ/mol, how much energy is available from 1 mol of glucose via aerobic catabolism?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter6: Energy, Enzymes, And Biological Reactions

Section: Chapter Questions

Problem 4TYK: When glucose reacts with ATP to form glucose-6-phosphate: a. the synthesis of glucose-6-phosphate is...

See similar textbooks

Related questions

Q: In Biochemistry，What is the main characteristic of peptide bond？what does it means by partial double…

A: Introduction Amino acids are the building blocks of proteins. Proteins is the most abundant…

Q: 1. What is the effect of boiling in the test tube with starch solution and saliva?

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: One advantage of the protein structures solved by NMR comparing to the x-ray structures is: a. It…

A: Proteins are composed of amino acids attached together via peptide bonds. There are twenty standard…

Q: Which of these are components of animal fatty acid synthase (FAS)? B-ketoacyl reductase enoyl…

A: The majority of healthy human tissues primarily create new structural lipids from circulating…

Q: The glycerol phosphate shuttle moves reducing equivalents (electrons) from the cytosol to the…

A: Shuttle systems are the systems which help in the transport of electrons from NADH present in the…

Q: 31. Margarine is made from vegetable oil by a chemical process. Do you suppose this process converts…

A: Margarine is a product derived from vegetable oil, obtained by the hydrogenation,…

Q: Identify the type of glycosidic linkage present in the disaccharide below: O a (1-6) O a (1-4) 03(1…

A: Disaccharides are oligosaccharides composed of two monosaccharide units. The monosaccharide units in…

Q: Detergents disrupt hydrophobic interactions by coating hydrophobic molecules with molecules that…

A: Hemoglobin is an oligomeric protein with four polypeptides. The individual polypeptides are joined…

Q: If we were handed a tube of 2mg/mL BSA how much is required 20μL of each of the following…

A: Different concentrations of protein solutions are needed to be prepared during biochemical…

Q: 1a. Whats the difference between continuous and discontinuous synthesis? 1b. Why replication…

A: According to the semiconservative model of DNA replication proposed by Meselson and Stahl, each…

Q: The active site _______________. a. is the compound that an enzyme reacts with during the chemical…

A: The active site is that region of an enzyme where substrate molecules bind. The binding of substrate…

Q: how would you prepare a 3-fold dilution series

A: Serial dilution : A substance is diluted in a solution step by step in a serial dilution procedure.…

Q: 7. To what volume must 30 mL of a 2.5M NaOH solution be diluted to make a 0.4M solution?

A: Molarity is way of representing the concentration of a solution. Molarity is number of moles of…

Q: What is the principle involved in mucic acid test?

A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified into monosaccharides,…

Q: An allosterically regulated enzyme in the R state is unable to bind substrate at the active site.…

A: Allosteric site : It is a place or site on an enzyme where the molecule which is not a substrate can…

Q: Which of the following statements about alpha-helix and beta-sheet structure are true? More than one…

A: A protein's function depends on its structure. There are four levels of protein structure: primary,…

Q: Glycolisis is process that is reversible, meaning that any product that is being formed can easily…

A: During the catabolism of amino acids, for it to be used as a respiratory substrate, first the alpha…

Q: The octapeptide gly-cys-met-asn-lys-ala-tyr-gly was hydrolyzed consecutively by CNBr and then…

A: The octapeptide gly-cys-met-asn-lys-ala-tyr-gly was hydrolyzed consecutively by CNBr and then…

Q: Propose a pathway for the following compound to enter gluconeogenesis / glycolysis. In your pathway,…

A: The compound given is not a common biomolecule or metabolite. It is methanolglyoxal , the alcoholic…

Q: What volume of a 0.8 M glucose solution can be made from 50 mL of a 2M stock solution?

A: Stock solution is the given solution present in lab. From the stock solution, we make the working…

Q: Now use the equations above and the empirical values below to calculate VO₂ (the rate of oxygen…

Q: Give at least 5 sources of protein.

A: Protein is a biomacromolecule formed by repeating units of amino acids. They are the building blocks…

Q: A culture of E. coli growing in a medium containing the normal, lighter isotope of nitrogen (14N) as…

A: Recall that: An important characteristic of DNA replication is that it is semiconservative. Two…

Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…

A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Why can you not create a Ramachandran plot for RNA molecules? Is it possible to get a similar type…

A: Ramachandran plot is plot that describes the distribution of torsional angles called phi and psi ,…

Q: 1. Why are eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) important? 2. What are the…

A: Lipids are compounds that are soluble in organic solvents and insoluble in polar solvents such as…

Q: Figure 4.16 - Structure of the Heme Group N H Pyrrole OOC H₂C H₂C H₂C H₂CC HC C-C H = C HgC C NH N 1…

A: These images correspond to the structure or components of heme, an integral part of hemoglobin…

Q: Calculate the net charge on the following tripeptides at pH 5.0: (a) Leu-His-Asp [0] (b)…

A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…

Q: Draw: Amino-terminus on the left, Carboxy-terminus on the right L-Ala (aka S-alanine) D-Ala (aka…

A: Alanine is an amino acid with molecular formula C3H7NO2. It has a methyl group as side chain.…

Q: Draw the Gluconeogenesis pathway (pyruvate to glucose) and identify at most 5 different organic…

A: Gluconeogenesis is a metabolic pathway in which glucose is synthesized from certain non-carbohydrate…

Q: Because of the helix dipole, the phosphate ions are likely to bind to a. The side-chains of…

A: Function of a protein depends on it's three dimensional structure and structure of the protein can…

Q: a) Draw a non-covalent interaction between a water molecule and the charge on a phosphorylated…

A: Unlike covalent interactions where there is sharing of electrons between two atoms, in non-covalent…

Q: . The importance of recombinant DNA technology in pharmaceutical industry b. Potential products…

A: Recombinant DNA technology is an important tool as it allows for the manipulation of DNA fragments…

Q: will UPVOTE Kindly answer the question. 1. Do you think free amino acids will give a positive…

A: Proteins are responsible for most of the functional and structural capabilities of cells. Proteins…

Q: Using an arrow, draw the site of cleavage for the following peptide that is reacted by: Pepsin…

A: Any peptide or protein can be cleaved by numerous protein digestive enzymes such as pepsin, trypsin,…

Q: What charged groups are present in glutamate at a pH = 7? OA) 1× NH3+ B) 1 x COOT C) 1× NH3 and 1 x…

A: Glutamate is an amino acid with molecular formula C5H9NO4. It is considered as acidic amino acid due…

Q: Propose a pathway for the following compound to enter gluconeogenesis / glycolysis. In your pathway,…

A: Glycolysis is a collection of 10 enzymatically catalysed reactions that sequentially oxidise a…

Q: Please answer fast draw pyruvate carboxylase mechanism. cofsctors must include. label all…

A: Pyruvate carboxylase is an enzyme which catalyzes the conversion of pyruvate to carboxylase.…

Q: Describe the process of denaturation of protein.

A: The proteins are most active in their native structure. Native conformation of the protein is the…

Q: For the tetrapeptide KASE: a. Draw its complete protonic equilibria. Indicate the net charge of each…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: A pentapeptide has a titration curve that shows five inflection points for five equivalents of…

A: Amino acids contain ionizable groups. The ionic form of the amino acids depends upon the pH of the…

Q: How does ATP releases the energy used by the Cell/What happens to ATP for the energy release/what…

A: ATP is also known as adenosine triphosphate. ATP is also called the energy currency of the cell. ATP…

Q: The brown discoloration of apples and potatoes is due to an enzyme catalyzed chemical reaction.…

A: Cut apples and potatoes turn brown or discolored on exposure to air. This is due to conversion of a…

Q: A dialysis tube that contains 10 mL of a 5% sucrose solution and that is permeable to water but not…

A: It is the movement of water from higher water concentration to lower water concentration through a…

Q: At a pH of 10, would you expect this peptide to be retained for a longer time within an anion…

A: Ion exchange chromatography separates molecules based on their charge difference. A cation exchange…

Q: The graph is an example of the rate of product production by an enzyme when the substrate is in…

A: An enzyme has substrate binding site. When substrate binds to that site, the reaction takes place.…

Q: Which of the amino acids does NOT have an aliphatic side chain? a. Lysine b. Alanine…

A: R groups in aliphatics are nonpolar and hydrophobic. The hydrocarbon chain's hydrophobicity rises as…

Q: Identify basic structure of the 8 types of membrane proteins shown below Understand how primary…

A: According to the fluid mosaic model of the plasma membrane is a phospholipid bilayer that has…

Q: You've discovered a novel biosynthetic pathway that makes the molecule caffeine. The pathway can be…

A: In biochemistry, a metabolic pathway is series of enzyme catalysed reaction where product of one…

Q: Assumed that you have isolated the protein cytochrome C from a cell lysate. Discuss the advantages…

A: Cytochrome C Cytochrome C is a protein that is loosely bound to the inner membrane of mitochondria…

Question

16. If the aerobic catabolism of 1 mol of glucose yields 38 mol of ATP, and the energy released by
aerobic ATP hydrolysis to ADP is -46 kJ/mol, how much energy is available from 1 mol of
glucose via aerobic catabolism?
17. A particular 70-kg man has a basal metabolic rate (BMR) of 7000 kJ/day. A large mouse
weighing 30 g has a BMR of about 20 kJ/day. In each case, what is the BMR expressed per kg of
body mass?
18. The allometric equation is BMR = aWb. For mammals, the value of a is approximately 293
kJ/day and the value of b is 0.75. What is the predicted BMR for a blue whale of 100,000 kg?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

1. Assuming that everything that’s needed to make tripalmitin comes from glucose, how many glucose would be used by adipose tissue in the synthesis of 1 mol tripalmitin? 2. How many ATP would be used (net of produced and used)? 3. If an animal absorbs 35 g glucose (MW = 180 g/mol) from drinking a can of pop, how many grams of tripalmitin (MW = 807 g/mol) can be produced from it in adipose tissue? Please provide only typed answer solution no handwritten solution needed allowed
1. What is the effect of arsenate poisoning on glycolysis. 2. Give an account of the total ATP yield when I molecule of glucose is converted to carbon dioxide and water?
10) The phosphorylation of glucose is an unfavorable reaction, with ΔG°’ = 13.8 kJ/mol. We can couple this to the favorable reaction of ATP hydrolysis to make the overall process favorable. a) Describe how this works. b) If ΔG°’ for ATP hydrolysis = -32.2 kJ/mol, what is the overall ΔG°’ of the reaction?
6.Carbohydrate oxidation is faster than fat oxidation, and glucose is used first as the preferred energy source in skeletal muscles during intense physical activity. A.Explain the roles of anaerobic and aerobic oxidation of glucose for energy (ATP) production during intense physical activity. You may draw a figure to explain the anaerobic and aerobic oxidative phases of glucose oxidation. B.Explain what oxygen debt means, and how it is related to oxygen deficit during intense physical activity.
1. How many ATP is produced in one molecule of glucose that undergo glycolysis plus oxidation of pyruvate to acetyl CoA? 2. Galactose and fructose can also used as substrate for glycolysis. Their conversion into a substrate that can enter into the glycolytic pathway involves the use of how many ATPs? 3. How many ATPs are produced when the product of glycolysis undergoes anaerobic respiration?
1 = 2, for sufficiently large values of 1. The energetic equivalent of two molecules of ATP is used to activate an amino acid, yet only one molecule of ATP is used. Explain
1) An average middle-aged person weighing 90 kg (200 lb.) contains 15 % body fat stored in adipose tissue. a) Calculate the amount of energy stored as fat in this person in kilojoules, assuming that energy yield from fat is 37 kJ/g. b) If this same amount of energy were stored in hydrated glycogen rather than fat (hydrated glycogen has an energy yield of 6 kJ/g), how much would the person weight in kilograms and in pounds?
1) How many net ATP molecules are gained from glycolysis of 1 glucose molecule?
10How many moles of ATP are generated by the complete oxidation of the fatty acid 22:3 in the presence of a functional electron transport chain and oxidative phosphorylation? Give your answer in moles, but don't include the units in your answer
A total of 30.5 kJ mol-1 of free energy is needed to synthesise ATP from ADP and Pi when the reactants and products are at 1.0 M concentrations and the temperature is 25oC. Because the actual physiological concentrations of ATP, ADP, and Pi are not 1.0 M, and the temperature is 37oC, the free energy required to synthesise ATP under physiological conditions is actually ~ 46.2 kJ mol-1. A 68 kg adult requires an energy intake of 8,550 kJ of food per day (24 hours). Calculate the mass (in Kg) of ATP synthesised by a human adult in 24 hours, assuming that the percentage efficiency of converting inputted calories in ATP is 50%. What percentage of the body weight does this represent?
Which of the following statements is false? Imagine that you ingested three chocolate bars just before sitting down to study this chapter. Most likely: a. your brain cells are using ATP. b. there is no deficit of the initial substrate to begin glycolysis. c. the respiratory processes in your brain cells are moving atomsfrom glycolysis through the citric acid cycle to the electrontransfer system. d. after a couple of hours, you change position and stretch torest certain muscle cells, which removes lactate from thesemuscles. e. after 2 hours, your brain cells are oxygen-deficient.
Aerobic cellular respiration results in the production of these two products. NADH and FADH2? ATP and pyruvate ATP and glucose ATP and H2O