2. What do you predict might happen to the cells of a fish that is accustomed to living in fresh water if the fish were placed in salt water? Explain your answer. ✓✓

Q: Determine whether each of the following items are characteristic of either facilitated diffusion,…

A: Cell transport refers to the movement of substances across cell membranes either into or out of the…

Q: Define drug dependence and explain the difference between physical dependence and psychological…

A: A drug is a substance that, when introduced into the body, can change the way the body functions.…

Q: HI Molecule 2 Molecule 3 Legend: Thick black line - RNA. Thin black line - DNA. Thin dashed line -…

A: The polymerase chain reaction was given in 1985 by " Kary Mullis". It is a rapid in-vitro molecular…

Q: A qPCR instrument is able to measure the amount of DNA product present at the end of each PCR cycle.…

A: Dye-based quantitative real-time polymerase chain reaction also known as qPCR is a Molecular biology…

Q: 1. The following image shows a mechanism in which gene expression activity is regulated by ligand.…

A: In prokaryotes, the synthesis of the gene's transcript and its encoded protein product is termed…

Q: In species with internal fertilization, the eggs often are attached to the outside of the female's…

A: Brood chambers are specialized structures in some species with internal fertilization that provide a…

Q: During SDS-PAGE, glycoproteins migrate as relatively diffuse bands, whereas nonglycosylated proteins…

A: SDS-PAGE, short for Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis, is an analytical…

Q: 5' AAGACCTATATAATGACGAACGATATT 3 TTCTGGATATATTACTGCTTGCTATAA 5¹ Coding strand: Template strand: 3'

A: Untranslated regions (UTRs) are extra sequences found in mRNA that are not translated. UTRs include…

Q: Identify the base labeled B. cytosine thymine O adenine O guanine A C B D

A: Nucleotides are the building blocks of DNA and RNA. Nucleotide is composed of a sugar, phosphate and…

Q: The number of bacterial cells increases from X to 32,000,000 in 2 hr. The generation time is 20…

A: Bacterial growth refers to the increase in the number of bacterial cells in a population over time.…

Q: Which of the following would NOT be characteristic of a single-source non-compromised STR profile?…

A: Short tandem repeat (STR) profiling is a technique used for DNA fingerprinting and identification.…

Q: Based on the information from the following table and the provided phylogenetic tree, what kind of…

A: Classification means the arrangement of various species into a groups. In the world there are lots…

Q: The abundance of three mRNA transcripts, transcripts A, B, and C, was measured by real-time PCR. The…

A: In molecular biology, understanding the abundance of specific mRNA transcripts and their…

Q: One common secondary structure found in proteins in the a-helix. On the diagram below is an a-…

A: PROTEIN Proteins or polypeptides are biological macromolecules that are polymers of amino acids.…

Q: 1. Give three lines of evidence that Darwin used to support his Theory of Evolution by natural…

A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…

Q: Solution 1 Solution 2 M 16311 Solution 3 2.0 A 6. The following experiment was carried out at ILC…

A: Essential elements and nutrients are those that plants need to survive and complete their life…

Q: Which is the correct answer. I don't see it in your response.

A: The propagation of nerve impulses from one neuron to the next neuron occur at the synapse. The axon…

Q: 21. Before pollination occurs, what does an individual flower potentially have that an individual…

A: A flower is the reproductive structure of flowering plants (angiosperms) that is responsible for the…

Q: Contrast the activity of a tropic and a trophic hormone.

A: Tropic and trophic hormones are two types of hormones that have distinct roles in regulating…

Q: 1. Circle the bonds in the drug molecule below that could be hydrolyzed by metabolic enzymes. OCH₂…

A: When an enzyme uses water to break a complex molecule into simpler substances then this process is…

Q: 3. What 3 types of proteins will have a signal peptide? Where in the cell does translation of these…

A: Cell to cell signalling is the communication of information between cells. Cell signalling and…

Q: Arrange the following four events in an order that explains the mass flow of materials in the…

A: Transportation in plants refers to the movement of water, minerals, and other substances from the…

Q: Antiretroviral drugs target various aspects of HIV replication and infection. Which of the following…

A: A combination of medications known as antiretroviral therapy (ART) works to stop several stages of…

Q: please answer with explanation and use text format as much as possible do not copy, thanks   Draw…

A: Lipids are a diverse group of biomolecules that are primarily hydrophobic and include fatty acids,…

Q: Organize the following steps in order of antibody production. A. CD40L-CD40 interaction turn on…

A: The process of antibody production begins with the activation of a CD4 T cell by a dendritic cell…

Q: Search information on size birds: Little 1.finches 2. Parakeets

A: Birds It refers to a group of warm-blooded vertebrates that belong to the class Aves. These…

Q: 5) Consider the following simulation result: Population Sizes 120 100 8 60 40 20 10 20 40 c) When…

A: In the graph we can see three different lines of different colours. Lets interpret them- Green line…

Q: 2) Indicate by writing “yes” or “no” whether amplification of a signal could occur at the particular…

A: An essential mechanism that permits cells to react to alterations in their environment is signal…

Q: List all the environmental impacts that occur during the "life span" of gasoline; that is, from…

A: Gasoline, also known as petrol, is a liquid fuel derived from crude oil that is used to power…

Q: When top-down control occurs within an intertidal zone along the rocky coastline of the Pacific…

A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…

Q: what diffulcitie one encounter when trying to differentiate bacteria on the basis of physiological…

A: Laboratory procedures called physiological tests for bacteria are used to ascertain the metabolic…

Q: What makes a trait susceptible to reversals in a phylogeny (microbial diversity)?

A: The variety of microorganisms found in a certain environment such as soil, water, air, or living…

Q: Explain how the human voice is produced. Describe briefly how each of the three main components of…

A: Voice is the vibration of sound that plays an important part in human life. An individual can…

Q: 5) Proteins do not serve what function within the cell? a. structural support b. antibodies c.…

A: Proteins are polymers that are made up of monomeric amino acids. The two amino acids hydrolyse to…

Q: The letters below represent a DNA strand. Determine the complementary DNA sequence by following the…

A: DNA replication is a biological process that occurs in living cells during which the DNA molecule is…

Q: A. The type of nucleotide mutation that occurred in the mutant sequence is a [Select] B. The type of…

A: “Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: At what DNA strand is the ACTB gene coded? How many ACTB genes are coded in this region?

A: The ACTB gene codes for the Beta-actin protein, which is a member of the actin protein family. Actin…

Q: When dealing with a complete dominant trait which of the following statements is TRUE? Heterozygous…

A: Complete dominance is a formed of dominance where in the dominant allele completely coverd with…

Q: 9. Answer all three parts of the following question: a. Explain how genetic drift can lead to a…

A: ANSWER) Genetic drift is a process of evolution that occurs randomly and can lead to changes in the…

Q: Which of the following factors DOES NOT affect pluripotency? O DNA Acetylation Oct4 Nanog miRNA's…

A: Pluripotency is the ability of stem cells to differentiate into all the cell types of an organism.…

Q: In our simple model of DNA amplification we assumed that a successful amplification doubled the DNA…

A: The question is asking us to consider a scenario where one allele in a sample is successfully…

Q: Which of the following types of cells belong to the adaptive immune response? Select all that apply.…

A: The immune system has two main components: the innate immune response and the adaptive immune…

Q: who invented Olaparib

A: A drug called olaparib is used to treat some cancers, specifically ovarian and breast cancers that…

Q: Which two organs of our body are most susceptible to drug toxicity and why?

A: Drug toxicity refers to the harmful effects of a drug or medication on an organism or its cells,…

Q: Arachidonic acid, eicosapentaenoic acid, or dihomo-gamma-linolenic acid undergo reactions that…

A: The prostaglandins (PG) are a class of lipid molecules with physiological activity that have a…

Q: How do inactivated vaccines prevent disease? Briefly describe what an inactivated vaccine is and…

A: Inactivated vaccines are a type of vaccine that contain killed or inactivated microorganisms, such…

Q: Since all cells contain the same number of chromosomes and the overall same/similar genome how would…

A: In multicellular organisms, cells with the same genetic material can exhibit diverse functions and…

Q: A tRNA that could “read” the 5’ GAA codon of glutamic acid would have the anticodon: Answer choices…

A: Transfer RNA (tRNA) is a type of RNA molecule that plays a crucial role in protein synthesis by…

Q: Which of the following is the best definition of generation time in a bacterium? the time it takes…

A: Bacterial growth refers to the increase in the number of bacterial cells in a population over time.…

Q: 1.What difficulties does one encounter when trying to differentiate bacteria on the basis of…

A: The catalase test is useful for differentiating staphylococci from streptococci because these two…

Human Evolution

Human evolution is the process of evolution of humans from early man to anatomically modern humans. The process of evolution in humans leads to the gradual development of traits like bipedalism. Humans are the highly social animals that make them the most advanced animal on Earth.  Human evolution is an outcome of interaction among the following processes: