Homework Help is Here – Start Your Trial Now!
Science
Biology
3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on the mRNA sequence below, write the added base. (Remember that the DNA template and mRNA are complementary. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5') CGUUACAAUGUAU_CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' On this mRNA codon table, the first nucleotide in codon is to the left, the second is above, and third is to the right. the omingood tRNA U U Phe Phe Leu C Ser Ser Ser A G Tyr Cys U Tyr C Cys STOP STOP A

3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on the mRNA sequence below, write the added base. (Remember that the DNA template and mRNA are complementary. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5') CGUUACAAUGUAU_CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' On this mRNA codon table, the first nucleotide in codon is to the left, the second is above, and third is to the right. the omingood tRNA U U Phe Phe Leu C Ser Ser Ser A G Tyr Cys U Tyr C Cys STOP STOP A

Biology (MindTap Course List)
Biology (MindTap Course List)
11th Edition
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Chapter12: Dna: The Carrier Of Genetic Information
Section: Chapter Questions
Problem 8TYU: The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is...
See similar textbooks
icon
Related questions
Question
3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on the mRNA sequence below, write the added base. (Remember that the DNA template and mRNA are complementary. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5') CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' On this mRNA codon table, the first nucleotide in codon is to the left, the second is above, and third is to the right. 4. A mutation in the gene encoding the aminoacyl tRNA synthetase for valine (VAL) causes the tRNA binding site to have the wrong shape. In its new (mutant) shape, the enzyme can bind tRNAs for VAL and leucine (LEU). (not at the same time but enzymes work fast and there are lots of them) a. In cells with this mutant tRNA synthetase, will the protein product of translation match the original one you deduced in question 2? circle one: (YES / NO. ) b. If not, how does it differ? c. How many different version of the short polypeptide will exist in this mutant cell? U U Phe C Ser Alle lle lle Met G Val Val Val Val A Tyr Tyr Cys G Cys Phe Ser Leu Ser Leu Ser STOP Trp C Leu Pro His Leu Pro His Leu Pro Gin Leu Pro Gin Thr Asn Thr Asn Thr Lys Thr Lys Ala Asp Ala Asp Ala Glu Ala Glu Arg STOP STOP A Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly DUAGUUAGDUAGUUAG Gly C C Α C А C Α
Transcribed Image Text:3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on the mRNA sequence below, write the added base. (Remember that the DNA template and mRNA are complementary. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5') CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' On this mRNA codon table, the first nucleotide in codon is to the left, the second is above, and third is to the right. 4. A mutation in the gene encoding the aminoacyl tRNA synthetase for valine (VAL) causes the tRNA binding site to have the wrong shape. In its new (mutant) shape, the enzyme can bind tRNAs for VAL and leucine (LEU). (not at the same time but enzymes work fast and there are lots of them) a. In cells with this mutant tRNA synthetase, will the protein product of translation match the original one you deduced in question 2? circle one: (YES / NO. ) b. If not, how does it differ? c. How many different version of the short polypeptide will exist in this mutant cell? U U Phe C Ser Alle lle lle Met G Val Val Val Val A Tyr Tyr Cys G Cys Phe Ser Leu Ser Leu Ser STOP Trp C Leu Pro His Leu Pro His Leu Pro Gin Leu Pro Gin Thr Asn Thr Asn Thr Lys Thr Lys Ala Asp Ala Asp Ala Glu Ala Glu Arg STOP STOP A Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly DUAGUUAGDUAGUUAG Gly C C Α C А C Α
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 3 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Virus
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Biology (MindTap Course List)
Biology (MindTap Course List)
Biology
ISBN:
9781337392938
Author:
Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:
Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:
9781305389892
Author:
Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:
Cengage Learning
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781938168130
Author:
Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:
OpenStax College
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Biology: The Unity and Diversity of Life (MindTap…
Biology: The Unity and Diversity of Life (MindTap…
Biology
ISBN:
9781337408332
Author:
Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:
Cengage Learning
SEE MORE TEXTBOOKS