Q: If there are two alleles, A and a, in a population and the population is at Hardy–Weinberg equilibri...
A: Answer=0.5 frequency of A would produce the greatest frequency of heterozygotes. Hardy and Weinberg ...
Q: Dinosaurs that lived with tyrannosaur rex what were their? Like any duck bills, hardosaur, sauropods...
A: Tyrannosaurus Rex or T. Rex are carnivorous dinosaur species that were found to have been lived in t...
Q: Brown fat metabolism generates about 10x more heat than white fat metabolism True False
A: This is true that brown fat metabolism generate about 10 x more heat then white fat metabolism conta...
Q: Identify the type of muscle found in the picture (choices: smooth muscle, skeletal muscle, or cardia...
A: Smooth muscle: it is usually unbranched, non-striated, and single nucleated muscle fibers. Skeletal...
Q: two questions:
A: the question 1. Which of these statements is/are NOT true about genetic drift? answer is on step 1...
Q: the greatest amount of oxygen? #analyze Water off the coast of Vancouver Island at 8°C Air at an ele...
A: As the height increases the oxygen concentration decreases. So with the increasing elevation the amo...
Q: The regulation of mRNA decay relies heavily upon deadenylasesand decapping enzymes. Explain how thes...
A: These classes of enzymes are critical to initiating mRNA decay by decapping of the enzymes that are ...
Q: What is pollination? What are the main forms of pollination?
A: Pollination is the process of extracting pollen grains from the male component of a flower, the anth...
Q: How do we know that alternative splicing enables one geneto encode different isoforms with different...
A: Alternative splicing is described as the process in which we need to do the process of selection of ...
Q: Which of the following situations describes a population at carrying capacity (K)? Group of answer ...
A: A population is an assembly of organisms of a single species occupying particular area of a given ti...
Q: 1. When can a mutation on the DNA cause shortening of the translation product? Give a specific examp...
A: A single nucleotide or nucleic acid can be affected by a point mutation. When one base is replaced f...
Q: Which of the following factors are not considered to be predictors of concussion severity? Linear vs...
A: ANSWER) Concussion is described as the brain injury due to any trauma, the trauma can be direct or ...
Q: Q5. If one strand of a DNA molecule has the following sequence of bases, what will be the sequence o...
A: Introduction: Adenine binds to thymine and guanine binds to cytosine as they are complementary base ...
Q: Fulfill the epidemiologic triad as to the host, agent, possible vectors, and environment of the Swin...
A: There are three parts of triad, Host, causative agent, vectors, environmental conditions.
Q: Chart the path of urine from the blood to the outside of the body and Why is high blood pressure dam...
A: Introduction The pressure of circulating blood against the walls of blood arteries is known as blood...
Q: what are the prevention,control and treatment of inflammatory diseases(Gout)?
A: Introduction: Gout is a metabolic disease in which crystals of uric acid gets deposited in joints, t...
Q: Which of the following is a risk factor for the development of cancer, but not also for diabetes and...
A: Risk factors for development of cancer : Tobacco Exposure to radiation Specific Chemicals Older age...
Q: Which of the following would NOT occur as a result of regular exercise to a specific muscle group (a...
A: The exercising involves the training of muscles by putting heavy load on them, due to exercising the...
Q: Gregor Mendel followed specific steps when breeding pea plants to determine the underlying cause and...
A: Introduction: Gregor Johann Mendel, an Austrian Monk, discovered the principles of heredity through ...
Q: Study the diagram below (figure1): Desert food web Hawks Desert foxes Scorpions Snakes Large lizards...
A: Introduction: A food chain is the sequence of biological community (an ecosystem) to obtain nutritio...
Q: In a longitudinal study, 100 children born on the same day were sampled in a population of interest,...
A: Fitness: it is frequently used to define the ability of individuals or population in terms of surviv...
Q: Describe one successful accomplishment of the U.S. Endangered Species Act. Now describe one reason s...
A: One successful accomplishment of the U.S. Endangered Species Act is: When the protection of the nor...
Q: Question 6 Which do these nutrients have in common? Vitamins D, C, and A zinc, selenium O they are a...
A: The body needs specific nutrition, vitamins, and minerals to overcome any kind of disease and built...
Q: Small body size Based on the phylogeny above large body size evolved in these frogs [X] times (place...
A: Phylogenetic tree: A phylogenetic tree is a graphic that shows how creatures have evolved over time....
Q: Which statement is accurate? Hormones that differ in effect reach their target cells by different ro...
A: Hormones are released from ductless glands called the endocrine glands into the bloodstream that rea...
Q: Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a disorder that affects the normal function o...
A: Introduction: X-linked inheritance means that disease is inherited due to the gene located on the X ...
Q: Many viruses that infect eukaryotic cells express genes that alterthe regulation of host gene expres...
A: Cluster of microRNA (miR)183 This miR family, which consists of miRs-183, -96, and -182, also is a ...
Q: The photomicrograph below shows mitotically dividing cells from whitefish (Coregonus lavaretus). a. ...
A: Cell division is process of making new body cells.
Q: Below is a figure representing DNA replication. One end of the DNA is labeled; given this informatio...
A: * DNA replication is a process in which double stranded DNA molecule is copied and hence produce tw...
Q: Movement of Earthquake waves through the ground can produce
A: Seismogram recording Are seismic waves like sea waves? Indeed, here and there. Sea waves travel at t...
Q: As described by the Optimal Foraging Theory, and animals feeding behavior should maximize ________ a...
A: Here the correct option is- 1. Maximize nergy obtained, minimize social interactions. And 3. Maximi...
Q: Determine what amino acid will be formed from the given DNA strand below: ...
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and...
Q: Amphibians live on land but are still restricted to living in areas with water, unlike reptiles and ...
A: Amphibians are ectothermic, tetrapod vertebrates of the class Amphibia. All living amphibians belong...
Q: How does extirpation differ from extinction? Group of answer choices Extinction and extirpation are ...
A: Q. How does extirpation differ from extinction? Group of answer choices : 1. Extinction and extirpa...
Q: Certain physical changes were necessary to allow human ancestral species to walk on two legs (bipeda...
A: Bipedalism is the ability to walk and running in two legs. The fossil structure says that the human ...
Q: What are the trends of the gametophyte in the evolution of plants?
A: Introduction In this question we will discuss about the trends of the gametophyte in the evolution o...
Q: Family name, scientific name, common name, hosts/damage, life cycle, morphological characters (Focus...
A: Moth Moth are the paraphyletic group of insects. All moth belong to order Lepidoptera.
Q: What does a mechanically gated channel respond to?a. physical stimulusb. chemical stimulusc. increas...
A: Although the cell's membrane is selectively permeable, only a few molecules can cross it directly. I...
Q: What do steroid and peptide hormones typically have in common? their solubility in cell membranes th...
A: The chemical substances that are synthesized and produced by the endocrine glands to control and reg...
Q: Rationalize on why a leaky heart valve might injure the heart overtime.
A: Leaky Heart Valve: When the heart beats, four valves of the heart open and close. They regulate blo...
Q: For which of the three types of land is the ratio of growth to removal greatest?
A: The growth-to- removals ratio is denotes by G:R is define as net growth divided by growing-stock rem...
Q: How are male gametophytes and male gametes formed in angiosperms?
A: Introduction In this question we will write how male and female gametes are formed in angiosperms.
Q: Where on the tree did the vertebral column evolve? Group of answer choices B D A E C
A: Chordates are evolved from some deuterostomes, as they have similitudes in embryonic development, so...
Q: Which of the statements below is true about good predictions? can select more than one answer Group...
A: A good prediction is is forecast about what will happen in the future it is based on experience and ...
Q: Which of the following is not an assumption made when evaluating Michaelis Menton kinetics? the reac...
A: An enzyme is a biocatalyst that increase the rate of chemical reaction without itself being change...
Q: Nucleotide Site 3 4 9. 10 Outgroup C G Sislaf rose C G G C G т C T Glozzom rose G G G A Pentwist ros...
A: Taxon on a tree A phylogeny, or evolutionary tree, represents the evolutionary relationships among a...
Q: Why do small Arctic mammals enter hibernation whereas larger mammals stay active during the winter m...
A: In winter, there will be an increase in metabolic demand to maintain optimal body temperature. It is...
Q: What is the evolutionary importance of the emergence of seeds in the plant kingdom?
A: Introduction In this question we have to discuss about the importance of the emergence of seeds in t...
Q: genetic information
A: DNA is genetic material of bacteria. Bacterial viruses like bacteriophages or any phages contain DNA...
Q: How long would it take a single bacterial cell to form 1,000,000 cells if it had a generation time o...
A: Bacterial Growth Calculation Bacterial development is the course of division of one cell to bring ab...
Step by step
Solved in 2 steps
- Answer the following questions. 1. Explain the steps associated with DNA profiling and state its advantages and disadvantages, 2. Describe how mutations are linked to DNA polymorphism. GUIDELINES: Each answer should be 250 words in length. Content should not be copied. References and bibliography should be provided for the content and images. please asapCan you please help with 1b please. picture with 1 graph is for question 1a) picture with 4 graphs is for question 1b) 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp fragments and put it through density gradient equilibrium centrifugation, you will find that all the DNA bands at the same place in the gradient, and if you graph the distribution of DNA fragments in the gradient you will get a single peak (see below). If you perform the same experiment with binturong DNA, you will find that a small fraction of the DNA fragments band separately in the gradient (at a different density) and give rise to a small "satellite" peak on a graph of the distribution of DNA fragments in the gradient (see below). Why do these two DNA samples give different results, when they're both 50% G-C? 1b) If you denatured the random 1000 bp fragments of binturong DNA that you produced in question 1a by heating them to 95ºC, and then cooled them down to 60ºC…Can you please help with 1c please picture with 1 graph is for question 1a) picture with 4 graphs is for question 1b) 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp fragments and put it through density gradient equilibrium centrifugation, you will find that all the DNA bands at the same place in the gradient, and if you graph the distribution of DNA fragments in the gradient you will get a single peak (see below). If you perform the same experiment with binturong DNA, you will find that a small fraction of the DNA fragments band separately in the gradient (at a different density) and give rise to a small "satellite" peak on a graph of the distribution of DNA fragments in the gradient (see below). Why do these two DNA samples give different results, when they're both 50% G-C? 1b) If you denatured the random 1000 bp fragments of binturong DNA that you produced in question 1a by heating them to 95ºC, and then cooled them down to 60ºC…
- What are some difficulties with low copy number DNA analysis? What kinds of checks and balances can a laboratory employ to ensure reliability of DNA profiles coming from low amounts of DNA templateWhat are the benefits of using a mixture classification scheme as outlined in DNA Box 14.1? What would be the advantages of using software for deciphering mixture components?See the attachment and answer the following parts of the question: A) If the binturong genome is 2.87 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'ATGGTCC3' and its complement, how many copies of this sequence are present in the binturong genome? B) Briefly explain, in your own words, why the fraction of the binturong DNA fragments that reannealed relatively slowly took so much longer to renature than the other DNA fragments. C) If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same sample that you used in the equilibrium density gradient centrifugation experiment described in part a and the C0t curve described in part b of this question) and used them as a sample in agarose gel electrophoresis, how many bands would you expect to find in the gel when you turned off the current and stained the gel with ethidium bromide? Briefly explain why you would predict that number of bands.
- In order to determine the purity of a DNA sample. spectrophotometry can be carried out at _______ to measure DNA, and _______ to measure protein. The ratio _______ is then calculated, and a number between _______ indicates higher purity. 280 nm; 260 nm; A280/A260; 0.5-1 260 nm; 280 nm; A260/A280; 0.5-1 260 nm; 280 nm; A260/A280; 1.5-2 260 nm; 280 nm; A280/A260; 1.5-2Is the DNA isolated from Cheek Cells using Saline solution, Detergent, and Ice-cold alcohol pure or not?Consider the four extraction/purification methods . a. Which extraction method would you use for a touch DNA sample? Explain your reasoning.b. Which extraction method would you use for a sample containing a mixture of primarily non-human and some human DNA? INFO: the 4 extraction methods are QIAamp manual extraction, QIAcube semi-automated extraction, DNA IQ extraction, or FTA punch purification
- 1.) What characteristics of VNTR and STR make them useful for DNA fingerprinting? 2.) How does PCR minimize the problems associated with degraded DNA? 3.) What factors can cause DNA to become degraded? 4.) If Ethidium bromide was not added to a gel, what would happen? 5.) How can you tell if an individual is heterozygous for the D1S80 marker? 6.) If a negative control produces a band, what does this indicate? 7.) In an experiment, a student’s sample amplified for D1S80 produced 3 bands. It was the only DNA sample run on the gel. The student knows that there was no problem with the Thermocycler or primers because the other students in the class had the expected results of only one or two bands. What is the most likely explanation for these results?Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…Why does evenly distributed peak in DNA chromatogram is an indication of a good sequence?