3. What is the difference between homologous and analogous traits? In your answer, describe an example of convergent evolution.

Q: What population will be directly affected if the sea otters leave the kelp forest? Predict the…

A: The term "population" typically refers to the number of people who live in a specific geographic…

Q: Illustrate the relationship between the following: Vitamin E, Vitamin C, Glutathione, alpha-lipoic…

A: Alpha-lipoic acid is a naturally occurring antioxidant in the body.

Q: Dichotomous Key minimum of 10 plant leaves, classifiying leaf type, phyllogeny, margin, shape, and…

A: Compound, serrated, and whole leaves are being regraded. A dichotomous key is a scientific tool for…

Q: SILICOSIS CAN OCCUR BY INHALATION 1. dust containing free silica 2. coal dust 3. asbestos dust 4.…

A: Side effects of silicosis generally show up after numerous long periods of exposure. In beginning…

Q: QUESTION 12 Consanguinity most often leads to an increase in prevalence (comapred to the general…

A: autosomal recessive disorder.

Q: Does Enterobacter aerogenes ferment? Does Enterobacter aerogenes produce indole?

A:

Q: Circulatory System 1. Why are the ventricles more muscular than the atria? 2. What valve prevents…

A: CirculatorySystem: The heart, blood vessels, and blood are all part of the blood circulatory system,…

Q: Male and female ruffed grouse look similar, except during courtship when the males raise their neck…

A: Ruffed Grouse are one of ten grouse species native to North America, and they are one of the…

Q: To examine: whether the statement "protein tyrosine phosphatases display exquisite specificity for…

A: Protein phosphatases are the enzymes which are involved in controlling diverse array of processes in…

Q: Which of the following examples DOES NOT involve negative feedback regulation?     Regulation of…

A: Introduction The tendency to retain a generally constant internal condition, amid alterations in the…

Q: 22.10 What causes acid rain? 22.11 How does acid rain damage trees? 22.12 How does acid rain damage…

A: Disclaimer: “Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: The calculated chi-square value which is 0 is less than the critical value which is 5.991 (under the…

A: Given values calculated chi-square value= 0 critical value = 5.991  degree of freedom = 2

Q: Phosphorylase kinase integrates signals from thecyclic-AMP-dependent and Ca2+-dependent…

A: Phosphorylase kinase which is abbreviated as PhK, has the responsibility to coordinate hormonal as…

Q: How hormones affect different classes of vertebrate?

A: Hormones are chemical substances that act like messenger molecules in the body.

Q: Which of the following statements about natural selection is not true? O Natural selection operates…

A: Natural selection is the process through which individuals with various phenotypes survive and…

Q: how will the body maintain homeostasis in osmoregulation

A: Homeostasis refers to an animal's capacity to manage different physiological cycles to keep the…

Q: 4. Give at least 2 major contributions of Cambrian explosion to evolution

A: 4. The Cambrian Period is significant in the evolution of life on Earth since it is when most of the…

Q: What is the mode of inheritance shown in this pedigree? II 1 3. 6. 7. 2 3 5 6 7 8 9 10 IV 1 2 3 5 67…

A: Since they lack a second copy of the X chromosome to give a dominant allele, any XY individual who…

Q: Give an example and explanation of how niche differences related to diet are manifest in differences…

A: Introduction Niche:- It is the particular area within a habitat occupied by an organism, it is the…

Q: what are 4 antagonistic interaction between two or more species that are exploited to improve…

A: Antagonist interaction between two species is the negative interaction where one species is…

Q: How could you prove that the Tn5 insertion was in the lac operon?

A: Genetic engineering (GE) is the intentional change of an organism's genetic structure, which…

Q: Which of the following is NOT a feature associated with bipedalism? O The legs are longer than the…

A:

Q: OB. metaphase

A:

Q: What information does the Shannon index provide? What different factors should you consider before…

A: The Shannon diversity index calculator is a tool that may be used to estimate species diversity in a…

Q: What population will be directly affected if the sea otters leave the kelp forest? Predict the…

A: Introduction The term "population" usually refers to the number of people living in a specific area,…

Q: Genetic variation is evident. The variation in your community is simple evidence of understanding…

A: Genetic Variation  Individual creatures of a species can have different gene sequences, which is…

Q: The structure of enzymes that just includes folding and is caused by hydrogen bonding only is called…

A: Introduction The three-dimensional arrangement of atoms in an amino acid-chain molecule is known as…

Q: 1. Which of the ff is NOT a form of asexual reproduction? A. Budding B. Fission C. Fragmentation D.…

A: Introduction :- In biology, budding is a type of asexual reproduction in which a new individual…

Q: The 2C units of acetyl CoA necessary for fatty acid synthesis in the cytosol comes from the 6C…

A: Fatty acid synthesis It is the process of the formation of fatty acids from 2 carbon molecules…

Q: What are the functions of ovaries in a flowering plant?? A. TO PRODUCE FEMALE GAMETES B. TO PRODUCE…

A: ovary, in flowering plants is enlarged basal portion of the pistil, the female organ of a flower.

Q: 14. An antibody can be best described as a A.white blood cells that engulfs an invading microbe B.…

A: Antibody - A protein made by plasma cells (a type of white blood cell) in response to an antigen (a…

Q: high temp can decrease the deamidation reaction true or false

A: Deamination occurs mostly in the liver, but it can also happen in the kidney. Deamination is…

Q: 1. Both parents have one dominant allele and one recessive allele. This means that they are…

A: Huntington's disease is a rare genetic condition that causes nerve cells in the brain to decompose…

Q: INDICATOR FOR EVALUATION OF EFFICIENCY OF WORK OF VENTILATION OF PREMISES OF RESIDENTIAL AND PUBLIC…

A: Answer is.. the content of harmful substances in the air.

Q: THE SPECIFIC POWER BACTERICIDAL LAMP CLOSED TYPE, SHIELDED BE LESS THAN (W / M ') 1. 1 2. 2-2,5 3. 4…

A: UVGI stands for Upper room ultraviolet germicidal irradiation.

Q: Using the meta-community concept, is it still possible to conserve species (communities) that are…

A: Habitat fragmentation happens when a big, unbroken piece of habitat, such as a woodland or natural…

Q: Define the following terms:   culture:     synthetic media:   complex media:   agar:…

A: Introduction Microbiology:- It is the study of all living organisms that are too small to be visible…

Q: NUMBER OF CARBON GAS (CO2) IN THE ATMOSPHERIC AIR 1.0,03-0,04% 2. 0,07 3. 0,1 4. 0.3 5. 4,0

A: Earth's atmosphere is composed of about 78% nitrogen, 21% oxygen, and one percent other gases.

Q: Write the characteristics of the seven taxonomic hierarchy in sentences/ paragraph and their…

A: The seven taxonomic hierarchy is.. species, Genus, Family,  Order, Class, Phylum or Division and…

Q: A patient is admitted to the surgery ward for an appendectomy. Describe the layers of muscles the…

A:

Q: Galactosemia is a recessive human disease that is treatable by restricting lactose and glucose in…

A: Galactosemia is a recessive human disease that is treatable by restricting lactose and glucose in…

Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…

A: Translation, in molecular biology and genetics, is the process by which ribosomes in the cytoplasm…

Q: explain the fluid regulation process in plants.

A: Introduction Osmoregulation is the active control of osmotic pressure in order to keep an organism's…

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A: DNA  contains the genetic information about the characteristics features of te organism present in…

Q: 4. WATER HAS THE PROPERTY OF ADHESION, WHICH ALLOWS IT TO USE WHICH PROCESS IN PLANT ROOTS? A:…

A: Ans is.. capillary action

Q: How much of 9XTBE (in ml) and how much water (in L) do you need to prepare 2 L of 1XTBE? I need I…

A: Given, 9xTBE and water. We need, 2L of 1xTBE solution. We will use the formula, M1V1 = M2V2 M1 and…

Q: 1. Explain in 2 sentences why Evolution walks a perilous tightrope between continuing and ending.

A: "Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: 1.Fatigue is caused because of formation and depositing of which among the following acids in…

A: Introduction Fatigue:- It is a term used to describe an overall feeling of tiredness or lack of…

Q: in certain fish the mating of black-scaled (B) with white a white-scaled (W)  will create offspring…

A: Introduction :- Fish are aquatic vertebrate animals having gills but no digits on their limbs, such…

Q: In which of the following situations would you expect to probably see differences in the speed of th…

A: Molecular clocks monitor the changes or mutations that accumulate in various gene sequences between…

Evolutionary lineages

An evolutionary lineage is a series of populations of organisms that descend from a common ancestor. Each species in the lineage is the direct consequence of evolutionary change from a common ancestor. A phylogenetic tree is generally used to display lineages visually. Lineages are components of the phylogenetic tree of life. Molecular systematics procedures are widely used to predict lineages.