4. Complete the table below to show the differences between active and passivetransport.Requires energy input bythe cellMolecules move along(down) a concentrationgradientMoves Molecules against(up) a concentrationgradientAlways involvesmembrane-spanningproteinsMolecules pass betweenthe phospholipidsMoves ions like Na* and K+Facilitated DiffusionPassive Diffusion (Passive Transport)xxActive Transport✓

Introduction: The cell membrane, also known as the plasma membrane or cytoplasmic membrane, is a…

Answered: 4. Complete the table below to show the…

4. Complete the table below to show the differences between active transport. Requires energy input by Facilitated Diffusion Passive Diffusion (Passive Transport) 7 7 A

Human Physiology: From Cells to Systems (MindTap Course List)

9th Edition

ISBN:9781285866932

Author:Lauralee Sherwood

Publisher:Lauralee Sherwood

Chapter3: The Plasma Membrane And Membrane Potential

Section: Chapter Questions

Problem 1TAHL: Which of the following methods of transport is being used to transfer the substance into the cell in...

See similar textbooks

Related questions

Q: A researcher would like to determine how much influence genes have on the development of traits.…

A: A genetic research is a kind of study of the genes and its function which helps to determine certain…

Q: If Mendelian inheritance was occurring, what would be the expected numbers of children in this…

A: Introduction: The transmission of traits from one generation to the next is the main topic of…

Q: Each statement in the five numbers below describes a situation in which a person makes use of the…

A: In a scientific setting, a hypothesis is a testable claim about the relationship between two or more…

Q: What are advantages and disadvantages of asymmetrical body plan in animals?

A: INTRODUCTION Asymmetrical bodies are a unique type of physique that is characterized by having a…

Q: In hamsters, black fur (B) is dominant over brown fur (b) and long fur (L) is dominant over short…

A: Probabilities are calculated in genetic analysis to determine the likelihood of a specific trait or…

Q: You observe a cell through a microscope and see that it has chloroplasts. To which Domain of…

A: Introduction Chloroplasts are cellular organelles found in the cells of plants, algae and some…

Q: Problem. A 1-year-old child was admitted to the clinic with signs of damage to the muscles of the…

A: Introduction :- Carnitine is an important molecule in muscle metabolism, as it plays a crucial role…

Q: For the bacterial growth curve below in which phase does the number of cell divisions equal the…

A: Bacterial growth curve is the representation of different stages of bacterial growth and death. It…

Q: Complete each statement by dragging each label into the appropriate blank. gain 2.0 hypotonic expand…

A: Introduction Tonicity is a term used in biology to describe the relative concentration of solute…

Q: aternal genotype. Maternal phenotype: Child phenotype: Paternal genotype: Reset A, M, Rh(neg) O, M,…

Q: 1) Which sequence represents the correct order of events for the production of necessary complex…

A: The group of chemical processes in organisms that maintain life is known as metabolism. The three…

Q: Which of the following organisms is most likely to have the highest total annual energy expenditure?…

A: Energy expenditure usually refers to the total amount of energy expended during biological processes…

Q: There can be more than one correct answer Which of the following methods can seperate proteins…

A: INTRODUCTION All living things require chemicals known as proteins. They are composed of amino…

Q: Stems bend towards the light because____ migrates to the dark side of the stem. phototropin…

A: The ability of plants to use light as an energy source for photosynthesis is referred to as…

Q: A 16-square Punnett is time-consuming to draw out. Dr. Thompson can easily solve this problem by…

A: Genetics is the study of heredity and variation in living organisms. It involves the investigation…

Q: 18 True Mytilus Mercenaria Neotrigonia Velesunio Hyridella Castalia Triplodon Etheria Glochidia…

A: Phylogenetic tree is used to represent the evolutionarily relationships among a group of organsisms…

Q: In the binomial naming system, scientific names are written in italics, with the first word…

A: Organisms are classified so that they can be grouped and their characteristics could be studied…

Q: Using the space below, draw of a cell membrane, including a. Phospholipid bilayer, b. Cholesterol c.…

A: Introduction: The cell membrane, also known as the plasma membrane, is a thin, semi-permeable…

Q: Clinical trials can be designed to demonstrate that a new technology offers measurable, relevant…

A: Clinical trial or often termed "medical trials" are research designs aimed to evaluate the…

Q: Which prenatal diagnostic method draws the fluid from the pregnant woman? ultrasound amniocentesis…

A: The tests used to determine fetal abnormalities and disorders during pregnancy are known as prenatal…

Q: Callorhinus 0.02885 Otaria 0.01393 Zalophus 0.01312 Ursus 0.05241 Mircunga 0.03426 Phoca 0.02614…

A: This is the cladogram marking the evolution of different types of seals with Ursus as an outgroup.…

Q: Skin color in humans is determined by a polygenic inheritance system, possibly involving as many as…

A: Introduction :- Gametes are reproductive cells, such as sperm cells in males or egg cells in…

Q: What does the future hold for genomes? How will they be different in 100, 1,000, 1 million, or 1…

A: Genome evolution is the term used to describe how an organism's genetic make-up gradually changes…

Q: Vol. concentrate (ml) 2 3 2 3 1. What are the different dilution factors based on the volume…

A: A micropipette is a laboratory tool used for transferring precise volumes of liquid. It operates on…

Q: Which term describes a substance that causes damage to the fetus during prenatal development? lanugo…

A: Prenatal development is the process by which a foetus grows and matures from conception to birth. It…

Q: Briefly explain WHY a 5 7-methylguanosine cap is only added to mRNA, not to tRNA or rRNA. (Please…

A: Introduction DNA is a self replicating molecule. Transcription is a process by which mRNA is…

Q: If the mutation occurred in Jonathan's somatic cells when he was in his 30's, what type of alleles…

A: A neurodegenerative condition that is primarily inherited is Huntington's disease (HD), also known…

Q: What 2 aspects can you observe in this animal DNA that indicates that it is the regulatory part of a…

A: The regulatory region of the eukaryotic transcription unit is characterized by multiple types of…

Q: In a child's genetic traits influence their social and physical environment. active gene-environment…

A: The environment may alter genes in a variety of ways. Epigenetic factors are variables that exist…

Q: Classify each statement as true or false. A mating between SS and Ss individuals will result in all…

A: The procedure of genes being passed from parents to children is referred to as inheritance. Genetic…

Q: uppose a father of blood type B and a mother of blood type O have a child of type O. What are the…

A: A, B, AB, and B are the four common blood types found in humans. The blood group can be RhD positive…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: For the following traits, what information must you have in order to predict the phenotype of an…

A: Answers : A. The maternal influence can be seen in the coiling of snails. When there is a maternal…

Q: The wild cress Arabidopsis thaliana is a diploid with 5 pairs of homologous chromosomes (i.e. 2n =…

A: Introduction :- Meiosis is a type of cell division that produces haploid cells, which contain half…

Q: 11.12 In jimsonweed, purple flower (P) is dominant to white (p) and spiny pods (S) are dominant to…

A: Introduction Dominant and recessive are terms used to describe the relationship between two…

Q: After a period of time without oxygen, the myocardium will undergo necrosis, a condition of…

A: Introduction :- Necrosis is a type of cell death that occurs as a result of injury or disease. It is…

Q: You have a 300 mOsM cell, and you place it in a solution that is 400 mOsM. Highlight the correct…

A: The tonicity of a cell is dependent on the solute concentration inside the cell and outside the…

Q: Describe how changes in the ladybugs'environment may influence their survival and/or reproduction.

A: Ladybugs belong to the phylum arthropods and are natural killers for many herbivorous insects. They…

Q: In 1975, the population of Peary caribou among the Arctic islands was around 28 000. In 1976, there…

A: To calculate the population change as a percentage, we need to find the difference between the…

Q: Provide the major types of transport that move substances across the cell membrane.

A: Introduction : The cell membrane or plasma membrane completely seprates the interior of a cell from…

Q: A doctor assigns a newborn infant an Apgar scale score of 9. This means that the infant shows…

A: The Apgar score is a popular tool for assessing a newborn infant's physical condition shortly after…

Q: Choose which one Hypotonic, Hypertonic, Isotonic

A: Introduction: The cell membrane, also known as the plasma membrane, is a thin, semi-permeable…

Q: How is collenchyma and sclerenchyma tissue similar

A: Collenchyma, parenchyma, and sclerenchyma are permanent tissues forming the ground tissue in the…

Q: 5. The electrochemical gradient can be utilised by ATP synthase to generate ATP - explain how the…

A: Photosynthesis - It is a process in which energy from sunlight is transformed into chemical energy…

Q: If a culture of E. coli you are tracking grows from 5 x 103 cells/ml to 9 x 107 cells per ml in 4…

A: Cell culture refers to the in vitro growth and maintenance of cells, typically of animal or plant…

Q: What structural elements of bacteria are essential, their functions?

A: INTRODUCTION : Bacteria : They are single cellular, microscopic organisms which have the ability to…

Q: Enzyme ptyalin pepsin trypsin small intestine Location mouth stomach Temperature (°C) 36.7-37.0…

A: The digestion is a process of breaking down the complex food components into the smaller components.…

Q: II. Objectives: In this activity, we should be able to: A. extract DNA from a fruit; B. view the…

A: The experiment deals with the extraction of DNA from a fruit sample. DNA Extraction: When DNA is…

Q: What are mitosis and meiosis? These two processes are how parent cells produce daughter cells.…

A: Cell division is the process by which cell divides to produce daughter cells. There are two types of…

Q: Which can NOT be found in vessels? O a. Tyloses O b. Pits O c. O d. Resin Perforation plates

A: A vessel is a plant structure that distributes fluids such as water, sap, and nutrients from the…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

4. Complete the table below to show the differences between active and passive
transport.
Requires energy input by
the cell
Molecules move along
(down) a concentration
gradient
Moves Molecules against
(up) a concentration
gradient
Always involves
membrane-spanning
proteins
Molecules pass between
the phospholipids
Moves ions like Na* and K+
Facilitated Diffusion
Passive Diffusion (Passive Transport)
x
x
Active Transport
✓

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A characteristic of carrier molecules in a primary active transport pump is that: a. they cannot transport a substance and also hydrolyze ATP. b. they retain their same shape as they perform different roles. c. their primary role is to move negatively charged ions across membrances. d. they move Na+ into a neural cell and K+ out of the same cell. e. they act to establish an electrochemical gradient.
Visit this link (http://openstaxcollege.org/l/diffusion) to see diffusion and how it is propelled by the kinetic energy of molecules in solution. How does temperature affect diffusion rate, and why?
Which of the following methods of transport is being used to transfer the substance into the cell in the accompanying graph? a. diffusion down a concentration gradient b. osmosis c. facilitated diffusion d. active transport e. vesicular transport f. It is impossible to tell with the information provided.
A scientist compares the plasma membrane composition of an animal from the Mediterranean coast with one from the Mojave Desert. Which hypothesis is most likely to be correct? The cells from the Mediterranean coast animal will have more fluid plasma membranes The cells from the Mojave Desert animal will have a higher cholesterol concentration in the plasma membranes The cells’ plasma membranes will be indistinguishable The cells from the Mediterranean coast animal will have a higher glycoprotein content, while the cells from the Mojave Desert animal will have a higher lipoprotein content.
What happens across the membrane of an electrically active cell is a dynamic process that is hard to visualize with static images or through text descriptions. View this animation (http://openstaxcollege.org/l/dynamic1) to really understand the process. What is the difference between the driving force for Na+ and K+? And what is similar about the movement of these two ions?
Which of the following statements is false? Proteins in the plasma membrane can: a. transport ions. b. transport chloride ions when there are two mutant copies of the cystic fibrosis transmembrane conductance regulator gene. c. recognize self versus foreign molecules. d. allow adhesion between the same tissue cells or cells of different tissues. e. combine with lipids or sugars to form complex macromolecules.
The freeze-fracture technique demonstrated: a. that the plasma membrane is a bilayer with individual proteins suspended in it. b. that the plasma membrane is fluid. c. that the arrangement of membrane lipids and proteins is symmetric. d. that proteins are bound to the cytoplasmic side but not embedded in the lipid bilayer. e. the direction of movement of solutes through the membrane.
7. Which of the following membrane transport proteins would you expect to be the most selective (although not the most rapid)? the bicarbonate ion channel the glucose carrier protein the potassium ion channel the chloride ion channel the sodium ion channel
1.There are different processes for transport of molecules of ions across cell membranes. Explain briefly each process a. Simples diffusion b. Facilitated diffusion via carrier proteins c. Facilitated diffusion via ion channels d. Primary active transport e. Secondary active transport f. Endocvtosis g. Exocytosis h. Transcytosis 2. List four Physical factors that affect the rate of diffusion and how they will affect it. 3. What kind of molecules can pass through the plasma membrane of the cells through simple diffusion? Give brief discussion. 4. List the three main parts of a cell and explain their functions. 5. Define an organelle. Which organelles are surrounded by a membrane and which are not? 6. What is the key difference between passive and active process? 7. Why RNA transcription can still serve the needs of the cell even if its operation is slow compared to DNA?
1. In a passive process (passive transport) across a cell's plasma membrane, ______ differences drive the movement; while in an active process, the cell provides ______ to power the transport process. A. concentration, ATP B. ATP, concentration C. differential permeability , driving force D. driving force, differential permeability
5. All of the following membrane activities require ATP energy except? a. facilitated diffusion b. active transport c. sodium ions moving out of the cell d. protons pumps e. translocation of potassium into a cell
1)What is the second type of lipid that plays a major role in the plasma membrane? This lipid does not have polar and nonpolar regions (its not amphiphilic) but plays a critical role in membrane permeability. A)Triglycerdies B) Steriod hormones c) cholesterol 2) In _______________, a single substrate/solute move from a high concentration area to a lower concentration are without the aid of any additional molecules. A) Diffusion B)Facilitated diffusion C) Cotransport 3)Channel proteins require a confirmational change in order to properly function. A) Hydrophilic B) ionic C) Polar