41) Dideoxyribonucleotides (ddNTPs) are unusual in both the 2' and 3' hydroxyl groups have been aced with protons. A lab technician who was cking the lab freezer with nucleotide vials accidentally cked the dCTP bin with ddCTP vials. How would this or affect an in vitro DNA replication reaction? DNA replication would be impossible Replication will proceed normally until the first guanosine nucleotide is reached. Replication will stop without cytosine being inserted into the daughter strand Replication will proceed normally until the first guanosine residue is reached. The ddCTP will be inserted, then replication will stop.

41) Dideoxyribonucleotides (ddNTPs) are unusual in both the 2' and 3' hydroxyl groups have been aced with protons. A lab technician who was cking the lab freezer with nucleotide vials accidentally cked the dCTP bin with ddCTP vials. How would this or affect an in vitro DNA replication reaction? DNA replication would be impossible Replication will proceed normally until the first guanosine nucleotide is reached. Replication will stop without cytosine being inserted into the daughter strand Replication will proceed normally until the first guanosine residue is reached. The ddCTP will be inserted, then replication will stop.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 17RQ: Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication?...

See similar textbooks

Similar questions

EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
What basal trasncription factors can only bind to the dna within the pre-replication complex after tata binding protein (TBP) bends the DNA?
How is DNA synthesis in the Polymerase Chain reaction similar to, or different from, DNA synthesis during genome replication in cells?
1.1 What components must be available for DNA polymerase III to proceed with DNA synthesis during replication? 1.2 What will the consequences for the cell be if the following enzymes are not functioning? DNA polymerase III Primase DNA ligase
Define the following terms related to DNA replication: origin of replication, helicase, single-strand binding proteins, topoisomerase, primase, RNA primer, DNA polymerase III, DNA polymerase I, and DNA ligase.
Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication? Both eukaryotic and prokaryotic DNA polymerases build off RNA primers made by primase Eukaryotic DNA replication requires multiple replication forks, while prokaryotic replication uses a single origin to rapidly replicate the entire genome DNA replication always occurs in the nucleus Eukaryotic DNA replication involves more polymerases than prokaryotic replication.
Is the semiconservative replication of DNA perfect?
Assume that a certain bacterial chromosome has one origin of replication. Under some conditions of rapid celldivision, replication could start from the origin before thepreceding replication cycle is complete. How many replication forks would be present under these conditions?
Which are the most important features of DNA replication reflect threestrict requirements for DNA polymerase action?
In terms of the new DNA strands that are generated, what are the differences between replication and conventional polymerase chain reaction?
Please help me to answer the following: 1. Explain how the synthesis of a DNA daughter strand growing toward a replication fork differs from the synthesis of a daughter strand growing away from a replication fork. 2. The base sequence ACGTCT represents a portion of a single strand of DNA. Please draw the complete double stranded molecule for this portion of the strand and use the representation to illustrate the replication of the DNA strand.Please clearly identify the nucleotide bases involved, the new strands formed, and the daughter DNA molecules. 3. Please explain the origin of Okazaki fragments. Thank you very muxh for your help.
Complete the complementary strand: DNA replication ATTCGAGGCTAA