71) For viral protein translation a. IRES is used in IBV to initiate the translation b. HA and A proteins of the H1N1 Virus are translated by free ribosome and go back to the nucleus. c. The presence of the cap in the 5 end of the RNA genome is found in MERS coronavirus. d. the viral genomic protein found in the FMD virus is important to start the translation.

71) For viral protein translation a. IRES is used in IBV to initiate the translation b. HA and A proteins of the H1N1 Virus are translated by free ribosome and go back to the nucleus. c. The presence of the cap in the 5 end of the RNA genome is found in MERS coronavirus. d. the viral genomic protein found in the FMD virus is important to start the translation.

Name: 71) For viral protein translationa. IRES is used in IBV to initiate t
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 71) For viral protein translationa. IRES is used in IBV to initiate the translationb. HA and A proteins of the H1N1 Virus are translated by free ribosome and go back to thenucleus.c. The presence of the cap in the 5 end of the RNA genome is found in

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 1TYU: When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain...

See similar textbooks

Similar questions

A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex. Knowing that this virus transcribes its own mRNAs in the cytoplasm of human cells, why would Protein X be an effective virulence factor?
1.- Outline the general process of transcription (dna->rna) include a diagram a) include the basic enzymes involved and a description of their actions b) what is the product of transcription c)what will the cell do with the product d)where does the transcription take place in prokaryotic cell
: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the following coding sequence on the subsequent translation. CGA-UCG-GAA-CCA-CGU-GAU-AAG-CAU asap
(65) A new strain of influenza virus emerges that results in world wide pandemic of influenza. Affected persons lack pre-existing immunity to this strain. Which of the following genetic mechanism best explains the emergence of this pandemic strain? (A) Deletion (B) insertion (C) Point Mutation (D) Reassortment (E) Recombination
19.Identify the single most correct choice: a) Without an exception, all enzymes are proteins. ( b) Both 30S and 50S ribosomal subunits are needed for translation. ( c) Competitive inhibitors of an enzyme are those inhibitors that bind to a region of enzyme and force it to change conformation so the enzyme will not be able to interact with the substrate. d) Certain archaebacteria have RNA genome. e) b and d 20. the DNA of bacteriophages can get incorporated in the host DNA. True or false
190. What site in the large ribosomal unit will the first anticodon/initiator tRNA enter? A.P site B.Start anticodon C.A site D.E site
______is a function of the large ribosomal subunit A.endonucleasE B.tRNA transferase C. phosphorylase D.Transcription initiation E. peptidyl transferase
Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deleted
QuestionHuman ribosomes can translate the SARS-CoV2 genome because: A. it is reverse transcribed into a double stranded DNA version of the genome B. it is the equivalent of an mRNA C. it is turned into an mRNA by a virus-encoded enzyme D. Viral ribosomes translate the SARS-CoV2 genome, not human ribosomes
1. Transcription: a)State the role of RNA polymerase in gene transcription.b. Explain why the DNA is not used directly for protein translation (i.e., why is mRNA used instead?).c. Explain what occurs when a gene’s promoter region is open for RNA polymerase binding.d. Explain what occurs when a gene’s promoter regions is blocked from binding RNA polymerase.e. Explain how two cells, such as liver cells and skin cells, can become specialized in structure and function despite containing the same genome.
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
3. Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA