A concussion is a mild traumatic brain injury.  How might a concussion acutely affect hearing and balance? What are some potential long term side effects?

Q: Q.4. Explain why excessive dosage and abusive usage of drugs such as amphetamines, LSD and…

A: The following are some of its negative effects:

Q: Q.3. Explain the terms: 1. Race 2. Breed 3. Cultivars 4. Variety

A: Animal husbandry is the department of science that deals with the exercise of breeding, farming, and…

Q: In the diagram below, which of the following labels (in red) would represent single- stranded…

A: During DNA replication, the single-stranded DNA binding protein (SSB) wraps the single-binded DNA…

Q: A cell experiences a mutation where the DNA polymerase III enzyme can now add nucleotides to either…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: The divisions of the nervous system can be divided into the central and peripheral nervous system.…

A: The type of representation of nervous system is most akin to the conceptual hierarchy.

Q: The enzyme that removes the RNA primer from the Okazaki fragment is: A DNA ligase B DNA gyrase (c)…

A: The double standard DNA molecule is produced by the action of DNA volume range and the process…

Q: MULTIPLE CHOICE QUESTION Which of the following is not an example of homeostasis? Chenging…

A: Homeostasis is the phenomena occuring in the living body where constant condition is maintained…

Q: Weed scientists often say a happy, growing plant will die faster than one that is under stress from…

A: Callisto is a weedicide that is used to control the broad leaved weeds specifically used in corn…

Q: Describe the growth and reproduction of a zygote fungus

A: A fungus is a type of eukaryotic creature which comprises microorganisms like yeasts and moulds,…

Q: Defining occupational health and safety and its importance in the work environment.

A: occupational health deals with all aspects of health and safety in the workplace and has a strong…

Q: Which of the following statements is true when considering this figure? It represents natural…

A: ANSWER) (f) all of the above are true. The bottle full of marble and and the jar represents the…

Q: In order for transcription to begin, the DNA-duplex must be "opened" to allow RNA polymerase access…

A: RNA polymerase is an enzyme found in the nucleoplasm of nucleus. It is involved in the…

Q: Which is a common cause for the production of oncogenes?   a. defective ion channel proteins…

A: Cancer  The continuous uncontrollable division of defective cell can leads to the cancer.

Q: Question 3 What are the diseases associated with hypocomplementaemia and which complement deficiency…

A: Hypocomplementaemia is the disease of the immune system in which the amount of the complement…

Q: Q.1. Enumerate the post-transcriptional modifications in a eukaryotic mRNA.

A: The post transcriptional modifications :- 1 . Splicing : Here the introns are removed from the mRNA…

Q: quality assurance

A:

Q: How biofilm causes endocarditis in human

A: Endocarditis is an infection in which the germs attach to the inner lining or the valves of the…

Q: Question 33 RNA polymerase II: A is located in the nucleoplasm and transcribes the protein-encoding…

A: Transcription is the process which is required for formation of mRNA from template strand of DNA.

Q: 12. Below is a diagram of a cell. Which of the following is true? a. The cell is a plant cell,…

A:

Q: What are the primary and the secondary constrictions of a chromosome? What is the other name given…

A: Chromosome At the time of cell division the chromatin material get condensed to form chromosomes…

Q: A 3-point test cross produces the following numbers of offspring: The yellow cells are the…

A: The three point test cross data is given in the question. The three genes are involved in a three…

Q: Rowena was tasked to measure the actual magnification of her specimen mounted on a slide without…

A: A microscope is a piece of scientific equipment which magnifies very small objects that are too…

Q: Phosphofructokinase (PFK) catalyzes a key step in glycolysis. This enzyme is composed of three…

A: The most common causes of anemia in the elderly are chronic disease and iron deficiency. Vitamin B12…

Q: Question 52 All of the following describe the general mechanism of DNA synthesis EXCEPT: A synthesis…

A: DNA replication is the important step to protein synthesis. At the nucleoplasm of cell DNA…

Q: Evolutionary Sciences ask: O "Why" questions O "What" questions "How" questions O "When" questions

A: The main function of evolutionary scientists is how the today's organisms evolved into the current…

Q: f you lost your ability to walk, could you access all of your house? What would need to change?…

A: Whenever one loses their ability to walk, they become wheelchair bound. Hence, their house, car…

Q: Illustration of stages in Meiosis 2 with 10 chromosomes, explain briefly

A: Meiosis is a type of cell division that occurs in sex cells at the time of gamete formation. It…

Q: Q.1. Enumerate the post-transcriptional modifications in a eukaryotic mRNA.

A: There are 3 post-transcriptional modifications which are splicing, capping and tailing. The…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: . What is Ringworm? What are the different types of ringworm?

A: Ringworm is A highly contagious fungal infection of the skin or scalp. Ringworm is spread by…

Q: Question 3 Linear eukaryotic DNA molecules have many origins of synthesis. A True B False

A: Prokaryotic DNA is circular and has bidirectional replication. Unlike prokaryotes, eukaryotes have…

Q: In keeping with the style of Table 17-1, what would youcall organisms that are MM N OO; MM NN OO;…

A: The basic structural and functional units is usually defined as the way that they are been stated…

Q: iscuss the intestinal phase of gastric secretion regulation with examples

A: The digestive system is involved in a variety of processes, including food digestion and nutrient…

Q: Define the words phylogeny, phylogenetic tree and systematics

A:

Q: Q.1. Enumerate the post-transcriptional modifications in a eukaryotir mRNA.

A: Transcription is the process by which DNA is converted into messenger RNA. The following are…

Q: How Enteropathogenic E. coli influences carcinogenesis

A:

Q: Which of the following is required for RNA splicing to occur? A a free 5 hydroxyl created by…

A: In vertebrates, there are three signals for direct splicing: - 5/ splice site hydroxylation…

Q: Which of the following is the most accurate statement regarding the problem with using life…

A: Option 3 Life expectancy give you average of country but significant differences within groups of…

Q: Prepare a table to show the levels of organization specifying the examples per level.

A:

Q: Question 26 The initial event in the conversion of an hnRNA to the mature RNA which leaves the…

A: Answer is D

Q: Q.2. Describe the phenomenon in which two organisms occupying the same geographical area show the…

A: Introduction We will answer the question in below step.

Q: First find and label ATP Synthase on the diagram below. Make boxes and add the labels for ATP, ADP,…

A: Cellular respiration takes place in four steps glycolysis where glucose is converted into pyruvate.…

Q: 27. Based on your knowledge of the structure and organization of prokaryotic and eukaryotic gen…

A: Prokaryotes are primitive cells which have simple cellular organisation. They do not have any…

Q: Task 2 Week 15 4. FIGURE 4 shows sugar transport in phloem. Phloem A В 888 Source cell $8888 Sink…

A: Introduction The movement of materials across cell membranes is referred to as cell transport.…

Q: Sometimes, the young ones born have an extremely different set of eyes or limbs. Give a relevant…

A: The abnormalities in the development of organs in the newborn may result due to various reasons.…

Q: escribe extensions of Mendelian Analysis

A: In an over view, Mendel's laws have been extended to include Multiple Alleles Incomplete Dominance…

Q: what type of stem cells are found in the bone marrow and skin that go through mitosis frequently to…

A: Stem cells are unspecialized cells that has the ability to divide for indefinite periods and give…

Q: Q.6. Comment on the statement with reference to industrial melanism, "Evolution is apparently…

A: Introduction We have to comment on the statement given in the question.

Q: Question 48 The energetic driving force for the synthesis of the new strand is the removal of the…

A: Removal of pyrophosphate group yields energy which is then diverted to the formation of new strands…

Q: Anaerobic respiration in humans occurs primarily in muscle cells during high- intensity exercise.…

A: Primary source of fuel in muscles is glucose, for both aerobic and anaerobic metabolism. In aerobic…