A person’s blood type is the result of expression of a gene with three alleles. However, only 2 alleles are expressed in any cell. This gene determines what type of sugar molecule gets added to the red blood cell membrane. The alleles for this gene are codominant. Together, this means that:     a. only one allele is expressed and the other two are not expressed     b. two alleles are expressed, and both are dominant     c. if you took 10 single red blood cells from 1 person and looked at them, 1/3 would show 1 type of sugar molecule, 1/3 would have the 2nd sugar molecule, and 1/3 would have no sugar molecules on the surface     d. All of the above are true

Q: Compare and contrast insects with arachnids and myriapods.

A: Invertebrates with an exoskeleton, segmented bodies, and coupled hinged legs are known as…

Q: Chemicals are returned from the glomerular filtrate to the blood by A All of the above B…

A: ANSWER;-Reabsorption Explain;- Tubular reabsorption recovers items from the filtrate and returns…

Q: Development of insects are affected by many factors. Cite three major influencers and state how they…

A: Insects are the class of organisms that belong to the Phylum Arthropoda. Like any other Arthropod…

Q: The Environmental Protection Agency (EPA) regulates the use of all pesticides in the United States?…

A: The EPA or Environmental Protection Agency started its operation in the US in 1970. It is an…

Q: The posterior pituitary stores and secretes: O PTH and calcineurin O Insulin and glucagon O…

A: Hormones are known to travel in the complete bloodstream and are responsible for different moods,…

Q: As a warm-up, draw lines to match the animals with the sensory reception they exhibit. 1. Platypus…

A: Sensory receptors are specialised to receive certain kind of stimulus. Sensory receptors convert…

Q: How are Ca2+ channels involved in phototransduction? they cause neurotransmitter release even if no…

A: Introduction The sensory transduction of the visual system is called visual phototransduction. It is…

Q: Compare epigeal and hypogeal seedlings based on which grows quicker between epicotyl and hypocotyl.

A: The hypocotyl is the part of the embryonal axis that is beneath the cotyledon in a dicot embryo. The…

Q: What are the processes of the photochemical stage of the photosynthesis process?

A: Introduction :- Plants take in carbon dioxide (CO2) and water (H2O) from the air and soil during…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: How does the release of mast cell mediators following activation/degranulation result in…

A: Anaphylaxis: Anaphylaxis is a severe allergic reaction that can be life-threatening. It can happen…

Q: Serum sickness does begin immediately upon the production of anti-BSA antibodies. How does the…

A:

Q: Discuss the THREE (3) main stages crucial to microbial leaching of copper from a low-grade ore,…

A: Bioleaching involes microorganisms .Main copper minerals include sulfides, (CuFeS2) chalcopyrite,…

Q: Narrow spectrum Penicillin act on

A: Penicillins is a group of antibiotics which is mainly obtained from penicillium moulds like…

Q: How is the photic energy absorbed by chlorophyll transfered to ATP molecules in…

A: Introduction - Daylight is the essential wellspring of energy for photosynthesis. Green growth and…

Q: How can you use the scientific method to study ranaviruses

A: Ranaviruses are a kind of pathogens which infects ectothermic vertebrate species .

Q: 12.Place the following events of the acrosomal reaction in the correct chronological order.(This is…

A: Acrosomal Reaction:  A sperm must first fuse with the plasma membrane before penetrating the female…

Q: For the hierarchy of skeletal muscle organization, which accurately lists the order of structures…

A: The smallest functional unit of skeletal muscle organization is sarcomere. It is a highly organized…

Q: Mule Deer Use the passage to answer the question. This image shows a male mule deer (Odocoileus…

A: Zone reserved : They are the area  for conservation that is , it is untroubled area which is…

Q: Which of the following is NOTa regulatory function of the endocrine system? O Regulates skeletal…

A: Introduction The endocrine system's glands produce chemical messengers known as hormones, which…

Q: Draw and describe the two types of fertilization. Which representative chordates exhibits each type…

A: Reproduction is the biological process of producing offspring for their parents. It is an essential…

Q: In what mechanisms can genetic information be altered? What are the consequences of these changes?

A: Alteration or changes in genetic information is called mutation. Mutation can be spontaneous or it…

Q: missense mutation will influence the tertiary or quaternary structure of the protein (FGFR3). How…

A: Missense mutation A missense mutation specifically defines the kind of point mutation in which the…

Q: A good excercise strategy to lose wieght would be? A. Engage intense activities for 60 minutes per…

A: Exercise  Excersize is the any physical activity of body by which one can maintain physical fitness…

Q: Construct a Table to show the differentiation of the Germ Layers: ( It is a known fact…

A: Introduction The process of forming and developing an embryo from a zygote or a somatic cell is…

Q: The development of behaVior is a product of ang -- --- - O Genetics, environment O Money, education

A: The growth and the development of an organism depends on the heredity and the environment. Heredity…

Q: AT THE HIGH TEMPERATURE OF THE SUBJECTS WITH WHICH THE BODY OF THE PERSON IS CONCERNED, THE WAY OF…

A: Introduction Everyone's normal body temperature is varied and varies throughout the day. A high…

Q: With respect to the Multiple Sequence Alignment software tool, ClustalW, briefly give an overview of…

A: NOTE: Since you have posted multiple questions so we will be solving the first one for you. As per…

Q: While driving the car, you almost bump a nearby car. Your pulse is racing and you notice your pupils…

A: The autonomic system deals with the visceral  organs like the heart, stomach , gland and the…

Q: How does capillary electrophoresis differ from gel electrophoresis?   a) The capillary system can…

A: Gel electrophoresis is done in a vertical or horizontal plane with a polymeric matrix of…

Q: The cone system and the rod system: differ in response saturation at high levels of illumination O…

A: Answer :- Option (C) is correct. - are equally specialized for sensitivity of photon capture.

Q: THE FACTOR THAT DOES NOT AFFECT THE MICROCLIMATE 1. Illumination 2. air temperature 3. air humidity…

A: Microclimate means the climate of a small specific place within an area as compared to climate of…

Q: Which one of the following terms best describes a phospholipid. It consists of а: A. polar head and…

A: Phospholipids along with proteins are an important part of the plasma membrane. It is made up of…

Q: The following micornutrients are especially important to an athlete EXCEPT? A. Vitamin B B.…

A: Micronutrients are necessary for power generation, haemoglobin synthesis, bone density, appropriate…

Q: To achieve a moderate-intensity aerboic workout, what percentage of your maximal heart rate should…

A: Introduction Adults should have a resting heart rate of 60 to 100 beats per minute. In general, a…

Q: Name three parameters that need to be stably maintained inside a cell.

A: Homeostasis is a group of internal dynamics which biological systems maintains in order for…

Q: The cells that are found in tendons are called: A. osteocytes B. adipocytes C. haemocytoblasts D.…

A: Introduction - A tendon is a strong, flexible tissue cord that looks like a rope. Tendons are the…

Q: Thirst is a relatively poor indicator of dehydration for athletes? A. True B. False

A: Ans - B) False Physiologically thirst is a regulatory mechanism of the living organisms that…

Q: What are the processes of the photochemical stage of the photosynthesis process?

A: Introduction -The photochemical period of photosynthesis is otherwise called light response. It is…

Q: Interferon is a mechanism used to protect the cell that becomes infected with a virus. A. True B.…

A: Interferons are proteins that really can induce non - specific resistance to viral infection by…

Q: You have two populations of snakes in different enclosures in a zoo. In enclosure A the frequency…

A: Introduction The relationship between two versions of a gene is referred to as dominant. Each parent…

Q: n example of phase 2 reaction is: A Glucosidation Aromatic hydroxylation C) All of the above D)…

A: 5. The addition of hydrophilic compounds to the parent molecule, a poisonous intermediate, or a…

Q: The secretes growth hormone, which is also known as somatotropin. O thyroid O anterior pituitary O…

A: Hormones are referred to as the blood's chemical messenger. The hormones are released by different…

Q: What are the processes of the photochemical stage of the photosynthesis process?

A: Introduction Photosynthesis is the process performed by plants and other organisms to convert light…

Q: What variable will you change in this experiment? This is also called the Independent variable. How…

A: There are so many factors, that are known to affect the activity of an enzyme. Temperature is one of…

Q: Describe the mechanisms for antigen processing and presentation via MHC class I and class II…

A: INTRODUCTION Everybody's immune system is different, but it usually gets stronger as we get older…

Q: key function of rod photoreceptors is to: detect colors detect fine details in the visual field.…

A:

Q: ANSWER BRIEFLY: 2.In the presence of anticoagulants, bleeding time is prolonged. Why?  3. Name the…

A: Introduction The bleeding time is a medical test used to evaluate platelet function. It involves…

Q: Biology Question

A: Introduction  Taxonomy is the branch of science that deals with the classification of organisms in…

Q: Fill out the table to compare the sensory organs of the vertebrates. Use keywords only.

A: Vertebrates These are the animals that have a vertebral column or notochord at any part of their…

Hematology

Hematology is the branch of biology. Hematology is the medical field that deals with the treatment of blood disorders and cancers, such as hemophilia, leukemia, lymphoma, and sickle-cell anemia. Hematologists and hematopathologists are medical professionals who specialize in illnesses of the blood and its components.