A reciprocal translocation results from an exchange of chromosomal material between: O non-homologous chromosomes O non-homologous genes O homologous genes O alleles O non-homologous genes
Q: Draw two replicated, un-condensed, homologous chromosomes that have the genes A and E on them. This…
A: Homologous chromosomes - Homologous chromosomes is the pair of DNA. These chromosomes are present in…
Q: Which of the following is a gene abnormality in which two nonhomologous parts rearrange and fuse…
A: Mutation can be defined as an alteration in the sequence of the nucleotide of the organism's genome.…
Q: An inversion heterozygote has the following inverted chromosome:What is the result if crossing over…
A: Introduction Inversion: in this type of chromosomal abnormality there is usually two breaks happens…
Q: Which of the following is true for linked genes? a) Alleles of linked genes are often inherited…
A: According to Mendel, units of inheritance are discrete, occurs in pairs i.e. alleles and can stay in…
Q: The human X and Y chromosomes a. are about the same size and have approximately the same number…
A: Sex in humans can be determined by the type of male haploid gamete that fuses with the female egg.…
Q: What type of chromosomal rearrangement occurs o If two homologous chromosomes misalign at repeated…
A: Chromosomes carry the genetic material DNA. Chromosomes may undergo rearrangements that are the…
Q: Why are there no humans with monosomy 22? because chromosome 22 is very small, it is very stable and…
A: The correct option is shown below.
Q: Genes are arranged in a chromosome: Select one: O a. Irregularly O b. Orderly O c. Linearly O d. In…
A: Gene can be defined as a functional unit of heredity or inheritance .These are the small segments of…
Q: The various forms of any one gene are called? A. homologous B. homozygous C. Heterozygous D.…
A: Heredity: The transmission of the genes from the parents to the offspring or from one generation to…
Q: Three of the statements below are true statements and one is false. Select the FALSE statement. New…
A: Genetics describes the study of how traits are inherited. A trait can be defined as a basic…
Q: In addition to the predominant adult hemoglobin,HbA, which contains two α-globin chains and…
A: Crossing over occurs during prophase I of meiosis. The pairing of chromosome occurs at tandem…
Q: Genes that cause Prader-Willi syndrome and Angelman syndrome are closely linked along chromosome 15.…
A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…
Q: If we call the amount of DNA per genome “x,” name asituation or situations in diploid organisms in…
A: Introduction: Amount of DNA varies in the cell according to the phase it is in with respect to the…
Q: are forms of the same gene with small differences in their sequence of DNA. Alleles A O Histones .B…
A: Alleles are forms of the same gene with small difference in their sequence of DNA So, the correct…
Q: The genes which are located in homologous section of X and Y chromosomes are called------------(A)…
A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A few…
Q: A couple planning their family are aware that through the pastthree generations on the husband’s…
A: All the 46 chromosomes carry important information for the growth and development of the embryo. If…
Q: What causes monosomy and trisomy disorders? deletion insertion translocation O non-disjunction
A: Monosomy and trisomy- Monosomy = It is the type of aneuploidy when only one chromosome of a pair is…
Q: How many chromosomes are shown in a normal human karyotype? * 23 O 44 46
A: The complete set of chromosomes in an individual organism or species is known to be a karyotype.…
Q: What type of chromosomal rearrangement occurs o Crossovers at a repeated sequence on two…
A: Mutations are changes that occurs in the deoxyribonucleic acid (DNA) sequence, either due to…
Q: 5 6 10 11 12 13 14 15 16 17 18 19 20 21 22 Y This karyotype is indicative of: O a Aneuploidy of an…
A: Any organism contain a constant number of chromosomes within the nucleus of the cell. As a result of…
Q: Crossing over usually contributes to genetic variation by exchanging chromosomal segments between:…
A: Chromosomes are present inside the cell nucleus and made up of DNA (Deoxyribonucleic acid) molecules…
Q: Which of the following are associated with dynamic mutations? O Genomic imprinting O Trinucleotide…
A: First of all we will discuss that, what is dynamic mutation and its causes. Dynamic mutation is the…
Q: Which of the following is false regarding Down Syndrome? O can be caused by a Robertsonian…
A: The thread like structures seen inside the nucleus of every cells are called chromosomes. These are…
Q: What is the main function of the DNA? * O It can be mutated. It stores information for protein…
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: On average, what proportion of the genome in the following pairs ofhumans would be exactly the same…
A: Genome is a complete set of genes in organism needed for its normal body functioning. For example:…
Q: Which of the following events or processes can result in Patau syndrome, Turner Syndrome, or…
A: The gene is the basic unit of heredity. Most of the organisms have Deoxyribonucleic acid (DNA) as…
Q: Genes that influence a given characteristic and arealigned with one another on a chromosome pair…
A: The branch of biology which deals with genes and their heredity and the genetic variation is called…
Q: The genes for the eye-color of fruit flies are located in their X chromosome, or X – linked. (R…
A: According to the question, we have to answer the following questions - The genes for the eye color…
Q: An inversion heterozygote has the following inverted chromosome:What is the result if crossing over…
A: Step 1 Inversion is a change in chromosome structure in which part of the chromosome either gets…
Q: Which of the following describes the relationship between these three genes? > View Available…
A: In sexual reproduction, during the meiosis phase, DNA sequences that are near together on a…
Q: A couple planning their family are aware that through the pastthree generations on the husband’s…
A: The karyotype banding analysis is the test that is done in a person's DNA for finding the normal and…
Q: A cytogeneticist has collected tissue samples from members of acertain butterfly species. Some of…
A: In the question, there are two groups of butterflies given: the Canadian and Mexican and they were…
Q: Describe the imbalance in gene products that occurs in an individual with monosomy 2.
A: Chromosomes are carrier of deoxyribonucleic acid (DNA). DNA is the genetic material. Each species…
Q: Which of the following statements is FALSE about deletions? O it can cause Cri du Chat syndrome O…
A: A deletion is the absence of a portion of one chromosomal arm. To take out the intervening section,…
Q: What is characteristic of a pair of homologous (maternal and paternal) chromosomes? O a. G banding…
A: Introduction:- Homologous chromosomes, also known as homologs, are made up of two chromosomes, one…
Q: A male Drosophila from a wild-type stock is discovered to haveonly seven chromosomes, whereas…
A: In male drosophila, one member of chromosome IV has translocated to the distal end of Chromosome II.…
Q: Suppose genetic analysis reveals a serious mutation in a gene in the green region of the left-hand…
A: Chromosomes are filamentous bodies present in the nucleus. They have the ability of self-replication…
Q: Which of the following karyotypic sex chromosome abnormalities result(s) in a male phenotype?…
A: Genetic diseases are caused by mutations in genes.
Q: Variable expression of the MERRF syndrome arises from O recombination between nuclear and mtDNA O…
A: Myoclonic epilepsy with ragged red fibres (MERRF) is one of the mitochondrial disorders,…
Q: In organisms with the ZZ-ZW sex-determining system, from which of the following possibilities can a…
A: Introduction: In ZZ-ZW system of sex determination, female carries two different gametes i.e., ZW…
Q: Chromosomes O Are located only in the eggs and sperm, not the regular body cells O Each have a…
A: A chromosome is an organized package of DNA found in the nucleus of the cell. Each chromosome is…
Q: In organisms with the ZZ-ZW sex-determining system, from which of the following possibilities can a…
A: The Sex-determination system helps to determine sexual characteristics in an organism. Sex…
Q: Which of the following is unable to form a linkage group? O genes that are not located on the same…
A: The tendency of certain genes to stay together throughout chromosomal inheritance is known as…
Q: A pair of homologous chromosomes - 1 - 2 - 3
A: DNA (deoxyribonucleic acid) is the genetic material in all living organisms. DNA is composed of…
Q: A female will be mosaic for a particular gene if: O Females cannot be mosaic for a particular gene…
A: Female has two X chromosomes. Whereas male has one X and one Y chromosome.
Q: In Drosophila, the two mutations Stubble bristles (Sb) and curledwings (cu) are linked on chromosome…
A: Introduction: Chromosomes are the vehicles of genetic information. Mendelian genetics and gene…
Q: In the absence of recombination, sister chromatids have the following features EXCEPT for: O they…
A: Introduction :- The identical copies (chromatids) created by the DNA replication of a chromosome are…
Q: A normal female is discovered with 45 chromosomes, one ofwhich exhibits a Robertsonian translocation…
A: Introduction: Addition, deletion, inversion, and translocation of chromosomal segments are all…
Q: Which of the following does not apply to banding patterns in chromosomes O a. are unique O b. are…
A: After staining with a dye, chromosomal banding is defined as alternating bright and dark patches all…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- Which of the following types of chromosomal changes would youexpect to have phenotypic consequences? Explain your choices.A. Pericentric inversionB. Reciprocal translocationC. DeletionD. Unbalanced translocationWhich of the following events or processes can result in Patau syndrome, Turner Syndrome, or Klinefelter syndrome?a. nondisjunctionb. deletion of part of a chromosomec. crossing-overd. independent assortmentThe human X and Y chromosomes a. are about the same size and have approximately the same number of genes b. include genes that determine an individual's sex c. are almost entirely homologous, despite their different names d. are both present in every somatic cell of males and females alike
- Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.If we call the amount of DNA per genome “x,” name asituation or situations in diploid organisms in which theamount of DNA per cell isa. xb. 2xc. 4xAbnormalities in the number of X chromosomes tend to be milder than the same abnormalities in autosomes because of ________.a. deletionsb. nonhomologous recombinationc. synapsisd. X inactivation
- Draw two replicated, un-condensed, homologous chromosomes that have the genes A and E on them. This individual is homozygous recessive for A, and heterozygous for gene E. Be sure to label your chromosomesA tomato geneticist attempts to assign five recessivemutations to specific chromosomes by using trisomics.She crosses each homozygous mutant (2n) with each ofthree trisomics, in which chromosomes 1, 7, and 10 takepart. From these crosses, the geneticist selects trisomicprogeny (which are less vigorous) and backcrosses themto the appropriate homozygous recessive. The diploidprogeny from these crosses are examined. Her results, inwhich the ratios are wild type:mutant, are as follows:Which of the mutations can the geneticist assign towhich chromosomes? (Explain your answer fully.)In com, male sterility is controlled by maternal cytoplasmic elements. However, the presence ofa nuclear fertility restorer gene (F_) restores fertility to male sterile lines. Draw your simulated crosses male sterile female x FF male and give the genotypes and phenotypes of the offspring in each cross.
- . All the genes on one chromosome are said to form aa. chromosomal group.b. recombination group.c. linkage group.d. crossing-over group.A phenotypically normal individual has the following combinations of normal and abnormal chromosomes:The normal chromosomes are shown on the left in each pair.Suggest a series of events (breaks, translocations, crossovers, etc.)that may have produced this combination of chromosomes.An organism is described as Rr, with red coloring. Rr is the organism’s________ , while red color is its___________. This organism would be___________ (homozygous/heterozygous) for this color gene.