Answered: a. a single base and a single amino…

Name: Give typed full explanation not a single word hand written otherwise l
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Give typed full explanation not a single word hand written otherwise leave it A frameshift mutation changesO a. a single base and a single amino acidO b. the reading frame following the mutationO c. the reading frame up to the mutationOd usually noth

Science

Biology

a. a single base and a single amino acid O b. the reading frame following the mutation O c. the reading frame up to the mutation d. usually nothing, because they are com

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 9SQ

See similar textbooks

Similar questions

A mutation in gene changes a base pair from at to gc this change caused gene to encode truncated protein that is nonfunctional so an organism cannot produce offprince describe this mutation
A gene mutation changes an AT base pair to GC. This changecauses a gene to encode a truncated protein that is nonfunctional.An organism that carries this mutation cannot survive at high temperatures.Make a list of all the genetic terms that could be used todescribe this type of mutation.
If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
a mutation in dna that adds +1 ot -1 nucleotide or +2 or -2 nucleotides is called a______? (choose one answer only) A. frameshift mutation B. silent mutation C. nonsense mutation D. missense mutation
Which of the following is/are a transition mutation(s)? (select any that apply) A to T A to G C to G A to C C to A
A point mutation that replaces a purine with another purine, or a pyrimidine with another pyramidinea) Nonsense mutationb) Silent mutationc) Transition mutationd) Transversion
What kind of mutation normally has no consequence? please explain the answer a.transversions b.insertion c.silent d.nonsense
Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence. c) What type of mutation is present in the strand 3 '- ACGGTCAATATTGCTG - 5 d) Provide the entire mutated sequence of amino acids. e) Explain the effect that this mutation will have.
n gel electrophoresis of DNA, the different bands in the final gel form because the DNA molecules _______. a. are from different organisms b. have different lengths c. have different nucleotide compositions d. have different genes
A mutation changes a codon that specifies tyrosine into a stopcodon. This type of mutation is aa. missense mutation.b. nonsense mutation.c. frameshift mutation.d. neutral mutation.
The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And also the mutation type
What type of mutation is represented in the second strand of DNA? TACGGCACT TACGGCCACT answer choices A. Deletion B. Substitution C. No mutation D. Insertion