A.) Deletion mutation is a loss of a single base by damage. B.) Point mutation is when a nucleotide is paired with a wrong nucleotide during RNA replication. a. Statement A is correct b. Statement B is correct c. Both A and B are correct d. Both A and B are incorrect

A.) Deletion mutation is a loss of a single base by damage. B.) Point mutation is when a nucleotide is paired with a wrong nucleotide during RNA replication. a. Statement A is correct b. Statement B is correct c. Both A and B are correct d. Both A and B are incorrect

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Related questions

Q: Assume that A, B, C, D, E, F, and G are autosomal genes on different chromosomes. From the mating (p...

A: Here we will use the general multiplicity rule for finding the probability. According to the multipl...

Q: On which bone are the Temporal Lines located? Group of answer choices Frontal Radius Occipital Maxil...

A: Temporal Lines are located in frontal bones and parietal bones.

Q: How does the swim bladder varies in different aquatic environments?

A: The swim bladder or air bladder is an internal gas filled organ that contributes to the ability to c...

Q: Completely answer the following questions. WIll give upvote if complete. Instructions: Consider the...

A: Non disjunction- failure of homologous chromosomes or sister chromatids to split after metaphase in ...

Q: 1. How easy was it to predict the possible composition of the 1st filial and 2nd filial generations ...

A: Punnet square is a reliable method for predicting an individual's genotype and phenotype.How to make...

Q: 7. In simple terms, describe how crossing over is carried out. How does it generate variability?

A: The interchange of genetic material in the germ line is referred to as crossing over.During meiosi...

Q: PROBLEM SOLVING: In the human pedigree below, the filled symbols represent the affected individuals.

A: At the first glance it looks like it is linked to Y chromosome since all the males are only affected...

Q: it

A: Warrier and her collaborator, Jessica Hendy and archaeological scientist at the University of York, ...

Q: Which type of evidence for evolution is most accurate in determining evolutionary relationships–morp...

A: In biology, evolution refers to changes in an organism' features over numerous generations as a resu...

Q: PART I. THE THEORY OF EVOLUTION. DIRECTIONS: Complete the paragraph about evidence of evolution by c...

A: Introduction :- The theory of evolution is founded on the assumption that all species are connected ...

Q: Describe active transport, including cotransport.

A: Introduction :- The movement of molecules across a cell membrane from a lower concentration region t...

Q: ) Describe the role of the signal sequence and the signal recognition particle (SRP) in targeting an...

A: Every cells provide a set of separate segments for localization of proteins. The method of transport...

Q: Describe the importance of selectively permeable membranes andcompare the functions of carrier prote...

A: The plasma membrane is referred to as a selectively permeable membrane because it allows only partic...

Q: two specific functions that polyp structures are used for. For each function, discuss similarities a...

A: Polyp is the body form present in the phylum Cnidaria (Coelenterata) group animals. It is the cylind...

Q: What is the primary chemical difference between deoxyribose and ribose? Ribose contains fewer hydrox...

A: ANSWER;- d) Ribose contains more hydroxyl groups than deoxyribose EXPLAIN;- The ring is made of four...

Q: Explain anatomy of gymnosperms

A: Gymnosperms are 'seeds bearing plants' that have their ovules exposed i.e., ovules are without ovary...

Q: In 2013, there was an outbreak of methicillin-resistant Staphylococcusaureus (MRSA) at an NFL traini...

A: mecA is a gene found in bacterial cells which allows them to be resistant to antibiotics such as met...

Q: How does a healthy microbiome impact each individual?

A: The microorganisms’ community that can be found inside or on the human body come under the category ...

Q: how do organisms without a swim bladder behave?

A: * swim bladder is also called Air bladder and Gas bladder. *Swim bladder is an internal organ which ...

Q: 0.001234286 0.001801429 0.002045714 -4.14286E-05

A: An enzyme is a biological catalyst which increases the rate of reaction by reducing the activation e...

Q: Name three important functions of DNA.

A: DNA is deoxyribonucleic acid which acts as genetic material in all organisms present on Earth. DNA i...

Q: Provide one example of the Fusiform Face Area

A: The fusiform Face Area in simple terms means spindle shaped area. It is also known as fusiform gyrus...

Q: Can the study of bioenergetics be useful in controlling body weight? How?

A: Bioenergetics is the study of energy transformation. This covers the investigation of many cellular ...

Q: Suppose you do this test on a hypothetical Staphylococcal species with the antibiotics penicillin an...

A: Antibiotic It is an antibacterial chemical that is effective against bacteria. It aids in the treatm...

Q: Can you please interpret and discuss and mark, this gel electrophoresis results. DNA ladder sizes:...

A: A molecular-weight/ size marker, also referred to as a DNA ladder, is a set of standards that are us...

Q: DRAWINGS (Don't forget to label the visible cellular parts.) Interphase stage Prophase Metaphase Ana...

A: Mitosis is the called equatorial cell division, as both daughter cells have the same chromosome numb...

Q: Make simple diagrams tracing the life history of Schistosoma japonicum

A: Schistosoma japonicum: Schistosoma japonicum is a significant parasite and one of the main schistos...

Q: Solutes tend to diffuse from a region where they ar_____ concentrated to an adjacent region where th...

Q: 1. Gradualism is the theory that the earth’s features are the result of long-term processes that con...

A: In 1858, Charles Darwin and Alfred Russel Wallace released "the Origin of Species", which detailed D...

Q: List out Bone loading bearing's material properties (

A: ✓Bone mineral is a ceramic material and exhibits normal Hookean elastic behaviour, i.e. a linear str...

Q: The extinction of dinosaurs left gaps in the early ecosystems on earth. Explain briefly the aftermat...

A: Evolution is change in the species over a period of time.

Q: Catalase combines two hydrogen peroxide molecules(H2O2 + H2O2) to make two molecules of water. A gas...

Q: What are the three key features used to read chromosomes? Go to using karyptypes to predict genetic ...

A: Given: Chromosomes are long threadlike structure that is found inside the nucleus of cell. It is mad...

Q: During which phase does cytokinesis begin? What cell parts migrate to the poles during prophase? Wha...

A: Cell division in eukaryotes can be either mitosis or meiosis. Mitosis is an equational division in ...

Q: ______cannot diffuse across a lipid bilayer. a. Water molecules c. Ions b. Gases d. Nonpolar molecul...

A: A lipid bilayer surrounds the cells.

Q: What is the relationship between the population's surviving members and the environment? and what ro...

A: Population It is described as a group of individuals of the same species living in the same region. ...

Q: please help me do this question it's an essay question, it needs atleast 8 to 10 points

A: Host defenses are protective mechanisms against infections which consists of natural barriers such a...

Q: What is the sequence of events in receptor-mediated endocytosis?

A: Introduction: "Bulk transportation" refers to the movement of macromolecules, such as proteins or po...

Q: Describe the relationship of breathing and respiration, are they the same? Justify your answer.

A: INTRODUCTION In living organism breathing and cellular respiration are occurring their...

Q: PROBLEM SOLVING: In the human pedigree below, the filled symbols represent the affected individuals....

A: Genotype Genotype is the collection of all gene inside an organism.

Q: Identify a non-competitive inhibitor and the enzyme that it impacts. Describe how the competitive in...

A: Enzymatic activity turned up or down by activator and inhibitor molecules tat bind specifically to t...

Q: Explain what might happen in the food web if snakes were removed from the ecosystem Snake Frog Rabbi...

A: An ecosystem is defined as a structural and functional unit of ecology where plants, animals, and ot...

Q: Create a semantic web of the concept of Evolution by Charles Darwin and Alfred Wallace. EVOLUTION

Q: What are three aspects of your lifestyle that mightdirectly or indirectly contribute to decline in E...

A: Honeybees and many other insects are natural pollinators of a large number of plant species.

Q: Cystic fibrosis (CF) is an autosomal recessive condition triggered by the overproduction of sticky m...

A: Let the dominant allele be represented by C and recessive allele be represented by c. Hence, CC = do...

Q: More often than not, a teenager doesn't want to be seen with their parents. How can this be associat...

Q: Which of the following statements accurately describes water vapor? The liquid phase of water is ...

A: Climate change is shifts in weather patterns and temperature.

Q: What causes the lub-dub sound of a beating heart? A. Heart valves closing B. Muscles sliding against...

A: Answer- A. Heart valves closing. A healthy heart makes a lub-dub sound with each beat. This sound ...

Q: Explain what occurs during glycolysis, the Krebs (citric acid) cycle, and electron transport chain b...

A: GLYCOLYSIS : * It is an catabolic metabolic pathway which breakdown glucose into 2 molecules of pyr...

Q: You are testing the effect of a particular fertilizer on a plant's growth. Your control plants don't...

A: Hypothesis It's an assumption, that's put up for the purpose of argument and then examined to determ...

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

1. A.) Deletion mutation is a loss of a single base by damage. B.) Point mutation is when a nucleotide is paired with a wrong nucleotide during RNA replication.

a. Statement A is correct

b. Statement B is correct

c. Both A and B are correct

d. Both A and B are incorrect

Answer:

2. This is a process that produces a change in the structure of the DNA by forming adenine rather than guanine.

a. Reverse transcription of guanine

b. Alkylation of the 06-Guanine

c. Reverse translation of guanine

d. Methylation of guanine bases

Answer:

3. This type of DNA repair happens when you are removing a single damaged base of DNA strand.

a. Nucleotide repair

b. Base excision repair

c. Strand break repair

d. Base nucleotide replacement

Answer:

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following does not contribute to the stability of the DNA? A. The presence of hydrogen between nitrogenous bases. B. Presence of the N-glycosidic bond between the nitrogenous base and phosphate group C. Presence of phosphodiester bond between the sugar and phosphate group on the sugar-phosphate backbone. D. Hydrophobic interaction between stacked nitrogenous bases.
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'
The original DNA base sequence is 5’-AGCGTTACCGT-3’; a mutation in the DNA strand results in the base sequence 5’-AGGCGTTACCGT-3’. What can you conclude about the mutation? A. It is a frameshift mutation. B. It is a silent mutation. C. It is a deleterious mutation. D. It may result in a single amino acid change in the protein being coded for by this base sequence.
Okazaki fragments are ________. A. short RNA primers needed for initiation of polymerization B. fragments of DNA polymerase I that lack 5' → 3' exonuclease activity C. short stretches of DNA formed on the lagging strand D. the smallest subunits of DNA polymerase III
A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed orange lines. a) Which Okazaki fragment was made first, A, B, or C? b) When ligase joins fragments A and B, will it act at arrow 1, 2, or both?
a. This piece of DNA is cut by EcoRI, the resulting fragments are separated by gel electrophoresis, and the gel is stained with ethidium bromide. Draw a picture of the bands that will appear on the gel. b. If a mutation that alters EcoRI site 1 occurs in this piece of DNA, how will the banding pattern on the gel differ from the one that you drew in part a? c. If mutations that alter EcoRI sites 1 and 2 occur in this piece of DNA, how will the banding pattern on the gel differ from the one that you drew in part a? d. If 1000 bp of DNA were inserted between the two restriction sites, how would the banding pattern on the gel differ from the one that you drew in part a? e. If 500 bp of DNA between the two restriction sites were deleted, how would the banding pattern on the gel differ from the one that you drew in part a?
Base analogs are mutagenic because of which characteristic? a. They produce changes in DNA polymerase that cause it to malfunction. b. They distort the structure of DNA. c. They are similar in structure to the normal bases. d. They chemically modify the normal bases.
After several rounds of replication, if COVID19 RNA changes from 5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’ to 5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAG …. 3’ Which of the following describes the above event? a) an insertion mutation occurred b) a duplication mutation occurred c) a multi-points mutation occurred d) a point-series mutation occurred e) an inversion mutation occurred
Which of the following types of DNA damage would be hardest to repair using the DNA repair pathways?A. Complete removal of three nucleotides in the middle of one strand.B. A covalent bond between a base on one strand and a base on the complementary strand.C. Incorporation of a sugar other than deoxyribose into one strand.D. Covalent attachment of a short polypeptide to a single base.E. A covalent bond between a base and a deoxyribose on the same strand. Please explain why it's B
The following diagrams represent DNA molecules that are undergoing replication. Draw in the strands of newly synthesized DNA and identify (a) the polarity of the newly synthesized strands, (b) the leading and lagging strands, (c) Okazaki fragments, and (d) RNA primers.
A single DNA molecule contains two specific target sites separated by an intervening sequence. If site-specific recombination between these sites causes the intervening sequence to be released as a separate circular DNA molecule containing one target site, then the sites were oriented in A) opposite directions causing excision. B) the same direction causing excision. C) opposite directions causing integration. D) the same direction causing integration. E) the same direction causing inversion.
It is essential that RNA primers at the ends of Okazakifragments be removed and replaced by DNA becauseotherwise which of the following events would result?a. The RNA would interfere with topoisomerasefunction.b. The RNA would be more likely to contain errorsbecause primase lacks a proofreading function.c. The β-clamp of the DNA pol II dimer would releasethe DNA and replication would stop.d. The RNA primers would be likely to hydrogen bondto each other, forming complex structures that mightinterfere with the proper formation of the DNA helix