ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAA  Briefly discuss why mutant allele 1 fails to produce functional protein. Note that this mutation has no impact on the length of the mRNA transcribed from the gene.

Q: What is the significance of the P-Q (P-R) interval?

A: The heart is a muscular pumping organ that passes deoxygenated blood to the pulmonary organ and…

Q: What is the genotypic ratio

A: Dominant seed color-yellow - indicated by RR Recessive seed yellow- green - indicated by rr when…

Q: If a parent is type O blood will all their childre and or granchildren be type O why or why not?

A: ABO blood group is a type of multiple allelism. In ABO blood grouping, A and B show co- dominance.

Q: O Autosomal Dominant

A:

Q: What will happen to the person if she/he had more than or less than 46 chromosomes?

A: Each human cell ordinarily has 23 pairs of chromosomes, for a total of 46 chromosomes. A shift in…

Q: Explain why it is not possible for two parents, one with type AB blood and the other with type O…

A: Blood group is classified based on the presence and absence of antibodies and inherited antigenic…

Q: autosomal recessive autosomal dominant X-linked dominant X-linked recessive Y-linked

A: Answer: A pedigree is a fmily tree or chart made of symbols and lines that represent a person…

Q: CHILD #1 Genotype Phenotype | | | ||| From Edward From Jenna

A: Given: D = long eyelashes  d = short eyelashes B = Brown eyes        b = red eyes F = freckles…

Q: HH alleles are ________________ genotype.

A: Genes are the specific codes of these amino acids which produces a protein and alleles is the…

Q: Understanding x - linked dominant/ recessive inheritance patters

A: X-linked inheritance is specifically a sex linked inheritance where the trait inheritance within the…

Q: A man with thalassemia minor marries a normal woman.  What phenotypic ratios of thalassemia-affected…

A: Thalassemia is an inherited blood disorder in which the body makes an abnormal form of hemoglobin.…

Q: IV 2. What type.of inheritance pattem is this? 3. What is thhe genotype of individual -1? 4. What is…

A: Genetic inheritance means the passing down of genes throughout individuals in various generations of…

Q: According to an old celebrity rumor, L' nel Ritchie is Khloe Kardashian's dad. If Khloe were type O…

A: Khloe Kardashian is type O blood group, which means she have two alleles of IO (genotype IOIO). Now,…

Q: A phenotypically normal man, who has a hemophiliac brother, marries a normal woman, who is not a…

A: Hemophilia is an X-linked recessive disorder so, an individual inherits this disease from his mother…

Q: Maria has type O blood, and her sister has type AB blood. What are the genotypes of the girls’…

A: BASIC INFORMATION COMPONENETS OF BLOOD    It is the body fluid which helps in transportation of all…

Q: enotype AaDdEe is

A: The accompanying Punnett Square shows the genotype of F1​  age:  AbD abD​  abd AabbDd aabbDd​ ​…

Q: Match the Disorder to its description for numbers 11-15:

A: Any disorder of the nervous system leads to a neurological disorder. Any structural, electrical or…

Q: Dihybrid cross - inheritance in corn | Table 5.1 Dihybrid Cross Expected Corn PSu Psu RSU Dihybrid…

A: Let us first construct punnet square   psu Psu pSu psu PSu PP SuSu PP Susu pP SuSu pP Susu…

Q: male having genotype AaBbCC mates with a female having genotype aaBBcc.

A: The fork line method can be used by figuring the occurrence of each gene or set of genes to be found…

Q: If Zoe who has type B blood marries Steve who has type AB blood, what percent of their children…

A: Human blood grouping is genetically co dominant in nature , determines by three genes I A ,IB ,Io .…

Q: Homozygous for “ B” allele

A: Genetics is a study of genes, heredity, and genetic variation in an organism. Living organisms…

Q: are all genetic disorders inherited

A: Genetic disorders are diseases that are inherited genetically. Genetic disorder can be caused due to…

Q: B A In the image above, the tissue found at letter B is; Нaploid Diploid Neither

A: The above image belongs to the ferns. It is the prothallus of the fern developed from spores.

Q: Fragile X syndrome What is the prevalence of the trait or disorder?   two paragraphs

A: Fragile X syndrome (FXS) is a problem which causes primarily mental and scholarly incapacity. FXS…

Q: Crossing-over is all of the following EXCEPT

A: The exchange of genetic material between non-sister chromatids of homologous chromosomes is called…

Q: PUNNETT SQUARE: GENOTYPES: BB Bb - bb – PHENOTYPES: Belted -: Non-belted-;

A: A Punnett square is used to understand a typical monohybrid and dihybrid cross conducted by the…

Q: Andy and Anne do not have polydactyl. Is it possible for them to have a child with polydactyl?…

A: Polydactyly is a condition where an individual is brought into the world with additional fingers or…

Q: A woman with blood type B gives birth to a child with blood type B. Could a man with type A blood be…

A: The man with blood type A could be father of the child in case he is heterozygous for the blood type…

Q: Define amplified

A: Amplified is a term used to expand something.

Q: (b) Individuals A and B have both male and female children. Draw a genetic diagram to show how they…

A: Genetic cross between male and female.

Q: en the maternal red

A: D)  Follicle stimulating hormone

Q: Four children have the following blood types: A, B, AB, and O. Could these children have the same…

A:

Q: >chromosomal…

A: Codons are trinucleotide sequence that codes for specific amino acids and there are totals of 64…

Q: e-effect curve that is marked by the X is known as:

A: Dose effect curve is defined as the relationship between a given drug dose and its response. In this…

Q: Can two polydactylic people have a child without polydactyly? Please explain.

A: Polydactyly is a condition in which a baby is born with an additional finger or toe on each hand or…

Q: . A young woman in Hollywood sued a famous movie actor for support of her child, claiming that he…

A: Blood group phenotype in humans is controlled by multiple alleles, i.e., there are more than 2…

Q: Give the genetype t phenstype of the offspring,

A: Method:- The method done with the pencil is not the most accurate way to draw a Punnet Square.…

Q: Dominant vs. Recessive genes

A: The fundamental physical and functional unit of heredity is the gene.

Q: Red/green colorblindness X-recessive pedigree

A: Answer: X-linked recessive pedigree is a pedigree chart of a family in which the disease is transfer…

Q: From the cross EEFFGGDd * EEffGgDd, what is the probability will be EEEfGgDd

A: Genotype is the genetic makeup of an organism.

Q: If a man with type AB blood marries a woman with type O,what blood types would you expect in their…

A: Answer: Introduction: In order to determine the blood type of child, we can make assumptions about…

Q: Gene Allele

A: Genetics is the study of inheritance of traits.

Q: If two unaffected parents have an affected child, they must be what of the gene

A: Given condition:  Two unaffected parents have an affected child.  This is possible only when both…

Q: n normal gene and mother with diabetes

A: X-linked recessive inheritance refers to genetic conditions associated with mutations in genes on…

Q: Two parents with blood types A and O have a child who has type O blood. What is the probability that…

A: The above question is about the blood grouping system. Blood grouping is based on multiple allelism…

Q: Which of the males is the father?  -male1  -male2  - cannot tell from this gel

A: Child should receive DNA from either mother or the father. Some from the mother some from the…

Q: Parents = B+ and AB- Given these are b.g. of parents. If they have a child, what blood types…

A: To determine the blood group of the upcoming generation Karl Landstiener came up with the ABO blood…